ID: 1047674549

View in Genome Browser
Species Human (GRCh38)
Location 8:127185885-127185907
Sequence CTATCTCTATATATACACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047674544_1047674549 29 Left 1047674544 8:127185833-127185855 CCACTGCCCAAAGCTCATGGCCA No data
Right 1047674549 8:127185885-127185907 CTATCTCTATATATACACGAAGG No data
1047674546_1047674549 22 Left 1047674546 8:127185840-127185862 CCAAAGCTCATGGCCACAATTAA No data
Right 1047674549 8:127185885-127185907 CTATCTCTATATATACACGAAGG No data
1047674547_1047674549 9 Left 1047674547 8:127185853-127185875 CCACAATTAATTGCAAGAGAAGC No data
Right 1047674549 8:127185885-127185907 CTATCTCTATATATACACGAAGG No data
1047674545_1047674549 23 Left 1047674545 8:127185839-127185861 CCCAAAGCTCATGGCCACAATTA No data
Right 1047674549 8:127185885-127185907 CTATCTCTATATATACACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047674549 Original CRISPR CTATCTCTATATATACACGA AGG Intergenic
No off target data available for this crispr