ID: 1047674552

View in Genome Browser
Species Human (GRCh38)
Location 8:127185901-127185923
Sequence ACGAAGGAAGAAGTGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047674547_1047674552 25 Left 1047674547 8:127185853-127185875 CCACAATTAATTGCAAGAGAAGC No data
Right 1047674552 8:127185901-127185923 ACGAAGGAAGAAGTGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047674552 Original CRISPR ACGAAGGAAGAAGTGGAAGG TGG Intergenic
No off target data available for this crispr