ID: 1047675416

View in Genome Browser
Species Human (GRCh38)
Location 8:127196597-127196619
Sequence CTATTGGTTCTTCTGTTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047675416_1047675420 10 Left 1047675416 8:127196597-127196619 CCTTGTAACAGAAGAACCAATAG No data
Right 1047675420 8:127196630-127196652 TGACTTCTATTAGTAGAGACTGG No data
1047675416_1047675421 11 Left 1047675416 8:127196597-127196619 CCTTGTAACAGAAGAACCAATAG No data
Right 1047675421 8:127196631-127196653 GACTTCTATTAGTAGAGACTGGG No data
1047675416_1047675422 15 Left 1047675416 8:127196597-127196619 CCTTGTAACAGAAGAACCAATAG No data
Right 1047675422 8:127196635-127196657 TCTATTAGTAGAGACTGGGAAGG No data
1047675416_1047675423 19 Left 1047675416 8:127196597-127196619 CCTTGTAACAGAAGAACCAATAG No data
Right 1047675423 8:127196639-127196661 TTAGTAGAGACTGGGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047675416 Original CRISPR CTATTGGTTCTTCTGTTACA AGG (reversed) Intergenic