ID: 1047675418

View in Genome Browser
Species Human (GRCh38)
Location 8:127196613-127196635
Sequence AAGTCATGGATCAGTCCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047675418_1047675423 3 Left 1047675418 8:127196613-127196635 CCAATAGGACTGATCCATGACTT No data
Right 1047675423 8:127196639-127196661 TTAGTAGAGACTGGGAAGGTAGG No data
1047675418_1047675420 -6 Left 1047675418 8:127196613-127196635 CCAATAGGACTGATCCATGACTT No data
Right 1047675420 8:127196630-127196652 TGACTTCTATTAGTAGAGACTGG No data
1047675418_1047675422 -1 Left 1047675418 8:127196613-127196635 CCAATAGGACTGATCCATGACTT No data
Right 1047675422 8:127196635-127196657 TCTATTAGTAGAGACTGGGAAGG No data
1047675418_1047675421 -5 Left 1047675418 8:127196613-127196635 CCAATAGGACTGATCCATGACTT No data
Right 1047675421 8:127196631-127196653 GACTTCTATTAGTAGAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047675418 Original CRISPR AAGTCATGGATCAGTCCTAT TGG (reversed) Intergenic