ID: 1047675421 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:127196631-127196653 |
Sequence | GACTTCTATTAGTAGAGACT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1047675416_1047675421 | 11 | Left | 1047675416 | 8:127196597-127196619 | CCTTGTAACAGAAGAACCAATAG | No data | ||
Right | 1047675421 | 8:127196631-127196653 | GACTTCTATTAGTAGAGACTGGG | No data | ||||
1047675418_1047675421 | -5 | Left | 1047675418 | 8:127196613-127196635 | CCAATAGGACTGATCCATGACTT | No data | ||
Right | 1047675421 | 8:127196631-127196653 | GACTTCTATTAGTAGAGACTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1047675421 | Original CRISPR | GACTTCTATTAGTAGAGACT GGG | Intergenic | ||