ID: 1047675422

View in Genome Browser
Species Human (GRCh38)
Location 8:127196635-127196657
Sequence TCTATTAGTAGAGACTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047675416_1047675422 15 Left 1047675416 8:127196597-127196619 CCTTGTAACAGAAGAACCAATAG No data
Right 1047675422 8:127196635-127196657 TCTATTAGTAGAGACTGGGAAGG No data
1047675418_1047675422 -1 Left 1047675418 8:127196613-127196635 CCAATAGGACTGATCCATGACTT No data
Right 1047675422 8:127196635-127196657 TCTATTAGTAGAGACTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047675422 Original CRISPR TCTATTAGTAGAGACTGGGA AGG Intergenic