ID: 1047676707

View in Genome Browser
Species Human (GRCh38)
Location 8:127210460-127210482
Sequence CAGATGTTATTGATGAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047676706_1047676707 -3 Left 1047676706 8:127210440-127210462 CCTCGCTGCTGAAATCTGATCAG No data
Right 1047676707 8:127210460-127210482 CAGATGTTATTGATGAATCATGG No data
1047676705_1047676707 -2 Left 1047676705 8:127210439-127210461 CCCTCGCTGCTGAAATCTGATCA No data
Right 1047676707 8:127210460-127210482 CAGATGTTATTGATGAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047676707 Original CRISPR CAGATGTTATTGATGAATCA TGG Intergenic
No off target data available for this crispr