ID: 1047684914

View in Genome Browser
Species Human (GRCh38)
Location 8:127295185-127295207
Sequence AGCATTTGGGCCCTCCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047684914_1047684923 30 Left 1047684914 8:127295185-127295207 CCCATCAGGAGGGCCCAAATGCT No data
Right 1047684923 8:127295238-127295260 GTGTTTGCAAGCATGGGCTGCGG No data
1047684914_1047684922 24 Left 1047684914 8:127295185-127295207 CCCATCAGGAGGGCCCAAATGCT No data
Right 1047684922 8:127295232-127295254 AGTAGAGTGTTTGCAAGCATGGG No data
1047684914_1047684921 23 Left 1047684914 8:127295185-127295207 CCCATCAGGAGGGCCCAAATGCT No data
Right 1047684921 8:127295231-127295253 CAGTAGAGTGTTTGCAAGCATGG No data
1047684914_1047684919 -8 Left 1047684914 8:127295185-127295207 CCCATCAGGAGGGCCCAAATGCT No data
Right 1047684919 8:127295200-127295222 CAAATGCTCCAGCAGGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047684914 Original CRISPR AGCATTTGGGCCCTCCTGAT GGG (reversed) Intergenic