ID: 1047684917

View in Genome Browser
Species Human (GRCh38)
Location 8:127295198-127295220
Sequence TAATACCTGCTGGAGCATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047684917_1047684921 10 Left 1047684917 8:127295198-127295220 CCCAAATGCTCCAGCAGGTATTA No data
Right 1047684921 8:127295231-127295253 CAGTAGAGTGTTTGCAAGCATGG No data
1047684917_1047684924 24 Left 1047684917 8:127295198-127295220 CCCAAATGCTCCAGCAGGTATTA No data
Right 1047684924 8:127295245-127295267 CAAGCATGGGCTGCGGAGTCAGG No data
1047684917_1047684923 17 Left 1047684917 8:127295198-127295220 CCCAAATGCTCCAGCAGGTATTA No data
Right 1047684923 8:127295238-127295260 GTGTTTGCAAGCATGGGCTGCGG No data
1047684917_1047684922 11 Left 1047684917 8:127295198-127295220 CCCAAATGCTCCAGCAGGTATTA No data
Right 1047684922 8:127295232-127295254 AGTAGAGTGTTTGCAAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047684917 Original CRISPR TAATACCTGCTGGAGCATTT GGG (reversed) Intergenic