ID: 1047684919

View in Genome Browser
Species Human (GRCh38)
Location 8:127295200-127295222
Sequence CAAATGCTCCAGCAGGTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047684914_1047684919 -8 Left 1047684914 8:127295185-127295207 CCCATCAGGAGGGCCCAAATGCT No data
Right 1047684919 8:127295200-127295222 CAAATGCTCCAGCAGGTATTAGG No data
1047684915_1047684919 -9 Left 1047684915 8:127295186-127295208 CCATCAGGAGGGCCCAAATGCTC No data
Right 1047684919 8:127295200-127295222 CAAATGCTCCAGCAGGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047684919 Original CRISPR CAAATGCTCCAGCAGGTATT AGG Intergenic