ID: 1047684920

View in Genome Browser
Species Human (GRCh38)
Location 8:127295208-127295230
Sequence AAGCATTTCCTAATACCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047684920_1047684922 1 Left 1047684920 8:127295208-127295230 CCAGCAGGTATTAGGAAATGCTT No data
Right 1047684922 8:127295232-127295254 AGTAGAGTGTTTGCAAGCATGGG No data
1047684920_1047684924 14 Left 1047684920 8:127295208-127295230 CCAGCAGGTATTAGGAAATGCTT No data
Right 1047684924 8:127295245-127295267 CAAGCATGGGCTGCGGAGTCAGG No data
1047684920_1047684921 0 Left 1047684920 8:127295208-127295230 CCAGCAGGTATTAGGAAATGCTT No data
Right 1047684921 8:127295231-127295253 CAGTAGAGTGTTTGCAAGCATGG No data
1047684920_1047684925 25 Left 1047684920 8:127295208-127295230 CCAGCAGGTATTAGGAAATGCTT No data
Right 1047684925 8:127295256-127295278 TGCGGAGTCAGGCAGATCACTGG No data
1047684920_1047684923 7 Left 1047684920 8:127295208-127295230 CCAGCAGGTATTAGGAAATGCTT No data
Right 1047684923 8:127295238-127295260 GTGTTTGCAAGCATGGGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047684920 Original CRISPR AAGCATTTCCTAATACCTGC TGG (reversed) Intergenic
No off target data available for this crispr