ID: 1047684921

View in Genome Browser
Species Human (GRCh38)
Location 8:127295231-127295253
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047684915_1047684921 22 Left 1047684915 8:127295186-127295208 CCATCAGGAGGGCCCAAATGCTC No data
Right 1047684921 8:127295231-127295253 CAGTAGAGTGTTTGCAAGCATGG No data
1047684914_1047684921 23 Left 1047684914 8:127295185-127295207 CCCATCAGGAGGGCCCAAATGCT No data
Right 1047684921 8:127295231-127295253 CAGTAGAGTGTTTGCAAGCATGG No data
1047684917_1047684921 10 Left 1047684917 8:127295198-127295220 CCCAAATGCTCCAGCAGGTATTA No data
Right 1047684921 8:127295231-127295253 CAGTAGAGTGTTTGCAAGCATGG No data
1047684918_1047684921 9 Left 1047684918 8:127295199-127295221 CCAAATGCTCCAGCAGGTATTAG No data
Right 1047684921 8:127295231-127295253 CAGTAGAGTGTTTGCAAGCATGG No data
1047684920_1047684921 0 Left 1047684920 8:127295208-127295230 CCAGCAGGTATTAGGAAATGCTT No data
Right 1047684921 8:127295231-127295253 CAGTAGAGTGTTTGCAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047684921 Original CRISPR CAGTAGAGTGTTTGCAAGCA TGG Intergenic