ID: 1047684924

View in Genome Browser
Species Human (GRCh38)
Location 8:127295245-127295267
Sequence CAAGCATGGGCTGCGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047684917_1047684924 24 Left 1047684917 8:127295198-127295220 CCCAAATGCTCCAGCAGGTATTA No data
Right 1047684924 8:127295245-127295267 CAAGCATGGGCTGCGGAGTCAGG No data
1047684920_1047684924 14 Left 1047684920 8:127295208-127295230 CCAGCAGGTATTAGGAAATGCTT No data
Right 1047684924 8:127295245-127295267 CAAGCATGGGCTGCGGAGTCAGG No data
1047684918_1047684924 23 Left 1047684918 8:127295199-127295221 CCAAATGCTCCAGCAGGTATTAG No data
Right 1047684924 8:127295245-127295267 CAAGCATGGGCTGCGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047684924 Original CRISPR CAAGCATGGGCTGCGGAGTC AGG Intergenic