ID: 1047686519

View in Genome Browser
Species Human (GRCh38)
Location 8:127310294-127310316
Sequence CTGTGAGTATGTGATGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047686514_1047686519 30 Left 1047686514 8:127310241-127310263 CCATTTTTAGCTACCAAATTAGC No data
Right 1047686519 8:127310294-127310316 CTGTGAGTATGTGATGAGATGGG No data
1047686516_1047686519 8 Left 1047686516 8:127310263-127310285 CCAAGTTTTTTTTAATGCGAATA No data
Right 1047686519 8:127310294-127310316 CTGTGAGTATGTGATGAGATGGG No data
1047686515_1047686519 17 Left 1047686515 8:127310254-127310276 CCAAATTAGCCAAGTTTTTTTTA No data
Right 1047686519 8:127310294-127310316 CTGTGAGTATGTGATGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047686519 Original CRISPR CTGTGAGTATGTGATGAGAT GGG Intergenic
No off target data available for this crispr