ID: 1047688605

View in Genome Browser
Species Human (GRCh38)
Location 8:127327749-127327771
Sequence AAGAGTAGCAAGCTCATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047688605_1047688609 4 Left 1047688605 8:127327749-127327771 CCTGCCATGAGCTTGCTACTCTT No data
Right 1047688609 8:127327776-127327798 GTTCCTTTTGTACAAAATTTGGG No data
1047688605_1047688608 3 Left 1047688605 8:127327749-127327771 CCTGCCATGAGCTTGCTACTCTT No data
Right 1047688608 8:127327775-127327797 TGTTCCTTTTGTACAAAATTTGG No data
1047688605_1047688611 12 Left 1047688605 8:127327749-127327771 CCTGCCATGAGCTTGCTACTCTT No data
Right 1047688611 8:127327784-127327806 TGTACAAAATTTGGGTAAAGAGG No data
1047688605_1047688612 20 Left 1047688605 8:127327749-127327771 CCTGCCATGAGCTTGCTACTCTT No data
Right 1047688612 8:127327792-127327814 ATTTGGGTAAAGAGGATTCAAGG No data
1047688605_1047688613 29 Left 1047688605 8:127327749-127327771 CCTGCCATGAGCTTGCTACTCTT No data
Right 1047688613 8:127327801-127327823 AAGAGGATTCAAGGAGCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047688605 Original CRISPR AAGAGTAGCAAGCTCATGGC AGG (reversed) Intergenic
No off target data available for this crispr