ID: 1047689440

View in Genome Browser
Species Human (GRCh38)
Location 8:127336245-127336267
Sequence CTAGCTTACCAATTCTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047689440_1047689443 14 Left 1047689440 8:127336245-127336267 CCCAGAAAGAATTGGTAAGCTAG No data
Right 1047689443 8:127336282-127336304 TATGTAACATTCCAAAGCCCTGG No data
1047689440_1047689445 30 Left 1047689440 8:127336245-127336267 CCCAGAAAGAATTGGTAAGCTAG No data
Right 1047689445 8:127336298-127336320 GCCCTGGCTCTCAGTGACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047689440 Original CRISPR CTAGCTTACCAATTCTTTCT GGG (reversed) Intergenic
No off target data available for this crispr