ID: 1047694200

View in Genome Browser
Species Human (GRCh38)
Location 8:127386556-127386578
Sequence GTTTAGATCTACAGTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047694198_1047694200 -6 Left 1047694198 8:127386539-127386561 CCAGGCTGAATGGAGCCGTTTAG No data
Right 1047694200 8:127386556-127386578 GTTTAGATCTACAGTGAGAAAGG No data
1047694193_1047694200 20 Left 1047694193 8:127386513-127386535 CCAGAGTATAGGGCATTATAATT No data
Right 1047694200 8:127386556-127386578 GTTTAGATCTACAGTGAGAAAGG No data
1047694197_1047694200 -5 Left 1047694197 8:127386538-127386560 CCCAGGCTGAATGGAGCCGTTTA No data
Right 1047694200 8:127386556-127386578 GTTTAGATCTACAGTGAGAAAGG No data
1047694192_1047694200 21 Left 1047694192 8:127386512-127386534 CCCAGAGTATAGGGCATTATAAT No data
Right 1047694200 8:127386556-127386578 GTTTAGATCTACAGTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047694200 Original CRISPR GTTTAGATCTACAGTGAGAA AGG Intergenic
No off target data available for this crispr