ID: 1047694607

View in Genome Browser
Species Human (GRCh38)
Location 8:127391098-127391120
Sequence GTGTGTCAGGGGAAAGGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047694601_1047694607 -4 Left 1047694601 8:127391079-127391101 CCTTGCAGTGTGCATGGGAGTGT No data
Right 1047694607 8:127391098-127391120 GTGTGTCAGGGGAAAGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047694607 Original CRISPR GTGTGTCAGGGGAAAGGGAC CGG Intergenic
No off target data available for this crispr