ID: 1047699367

View in Genome Browser
Species Human (GRCh38)
Location 8:127434060-127434082
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1019
Summary {0: 82, 1: 298, 2: 258, 3: 133, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047699367_1047699370 -9 Left 1047699367 8:127434060-127434082 CCGTGTCCCATCTGTGTGGGACC 0: 82
1: 298
2: 258
3: 133
4: 248
Right 1047699370 8:127434074-127434096 TGTGGGACCCCACTGAAAATTGG 0: 173
1: 150
2: 196
3: 148
4: 190
1047699367_1047699374 9 Left 1047699367 8:127434060-127434082 CCGTGTCCCATCTGTGTGGGACC 0: 82
1: 298
2: 258
3: 133
4: 248
Right 1047699374 8:127434092-127434114 ATTGGACTGTTCAACTCACCTGG 0: 80
1: 374
2: 270
3: 81
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047699367 Original CRISPR GGTCCCACACAGATGGGACA CGG (reversed) Intergenic
900045036 1:498957-498979 AGACCCACACAGATGGGATTTGG - Intergenic
900066041 1:730456-730478 AGACCCACACAGATGGGATTTGG - Intergenic
900066835 1:737271-737293 AGACCCACACAGATGGGATTTGG - Intergenic
900067233 1:740687-740709 AGACCCACACAGATGGGATTTGG - Intergenic
900473859 1:2867290-2867312 GCTCCCACGCAGCTGGGGCAGGG - Intergenic
900722519 1:4186608-4186630 GGTCCTGCACAGATGGGACACGG + Intergenic
900840812 1:5047182-5047204 GGTCCCACACAGATGGGATGCGG - Intergenic
900847501 1:5115457-5115479 GGTCCCACACAGATGGGACGCGG - Intergenic
901250770 1:7777605-7777627 GGCCCCAAACAGATAGGAGAGGG + Intronic
901671473 1:10858537-10858559 GGTCCAAGACAGAGGGAACATGG + Intergenic
902050939 1:13563215-13563237 GGTCCAGCACAGATGGGACATGG - Intergenic
903396003 1:23002323-23002345 GGTCCTGCACAGATGGGACACGG + Intergenic
904711658 1:32434682-32434704 GGTCCCACAGAGATGGGACATGG - Intergenic
905060496 1:35135706-35135728 GGTCCCACACAGATGGGACGTGG + Intergenic
905340343 1:37273640-37273662 GGCCCCCCACAGATGGGCCAGGG + Intergenic
905429310 1:37909986-37910008 GGTCCTGCACAGATGGGACACGG - Intronic
905499802 1:38427416-38427438 GGTCCCACACAGATGGAACACGG - Intergenic
905976186 1:42175646-42175668 GGTCCCAGACAGATGGGAGGAGG - Intergenic
906080942 1:43087843-43087865 GGTCCTGCACAGATGGGACACGG - Intergenic
906744501 1:48212365-48212387 GGTCCTGCACAGATGGGACACGG + Intergenic
907078069 1:51595870-51595892 GGTCACACAGAGATGGAATAGGG + Intronic
907292654 1:53426631-53426653 GGTCCCACACAGATGGGACGCGG - Intergenic
907503546 1:54901236-54901258 GGTCCCGCACAGATGGGATGTGG + Intergenic
907521282 1:55024935-55024957 GGTCCCACACAGATGGGACGCGG - Intergenic
907995510 1:59627386-59627408 GGTTCCTCACAAATGGGAAAAGG + Intronic
908461692 1:64353343-64353365 GGTCCCACACAGATGGGATGCGG + Intergenic
908591932 1:65645251-65645273 GGTCCCACACAGATGGGACGCGG + Intergenic
908852428 1:68388600-68388622 GGTCCCACACAGATGGGACGCGG - Intergenic
909014728 1:70369730-70369752 GGTCCCACACAGATGGGACATGG - Intronic
909222639 1:72983205-72983227 GGTCACACACAGATGGGACGCGG + Intergenic
909223630 1:72991159-72991181 GGTCCCACAGAGATGGGACGTGG + Intergenic
909550998 1:76898149-76898171 GGTCTCACACAGATGGGATACGG + Intronic
909776669 1:79491938-79491960 GGTCCCGCACAGATGGGACGTGG + Intergenic
909788245 1:79642100-79642122 GGTCCCGCACAGATGGGACACGG + Intergenic
909909983 1:81247774-81247796 GGTCCCACACAGATGGGACGTGG - Intergenic
909978429 1:82070891-82070913 GGTCCCACACAGATGGGACGTGG + Intergenic
910002722 1:82358235-82358257 GGTCCTGCACAGATGGGACATGG + Intergenic
910049405 1:82957651-82957673 GGTCGCACACAGATGGGGCGCGG - Intergenic
910292852 1:85616146-85616168 GGTTCCACAAAGCTGGGGCACGG - Intergenic
910354763 1:86341845-86341867 GGTCCTTCACAGAGGGGACACGG - Intergenic
911071095 1:93832395-93832417 GGTCCCGCACAGATGGAACATGG - Intronic
911570416 1:99511954-99511976 GGTCCCACACAGATGGGACGTGG - Intergenic
911759759 1:101601410-101601432 GGTCCCGCACAGATGGGACATGG + Intergenic
911966947 1:104382522-104382544 GGTCCTGCACAGATGAGACATGG - Intergenic
912296494 1:108475286-108475308 GGTCCCGCACAGATGGGACACGG - Intergenic
912815289 1:112823843-112823865 GATCCTGCACAGATGGGACATGG + Intergenic
913095754 1:115513946-115513968 GGGCCCACACAGACAGGGCACGG + Intergenic
913159237 1:116130329-116130351 TGTGCCACACAGGTGGGTCAGGG - Intronic
913245149 1:116864437-116864459 GGTCCTACACAGATGGGACATGG - Intergenic
916328880 1:163593356-163593378 GGTCCCGCACAGATGGGACAAGG - Intergenic
916941813 1:169685202-169685224 GGTCCCACACAGATGGAACATGG - Intronic
917749676 1:178042312-178042334 GGTCCCGCACAGATGGGACATGG - Intergenic
918347141 1:183615982-183616004 GGTCCTACACAGATGGGACGTGG - Intergenic
918567648 1:185951675-185951697 GGTCCTACACAGATGGGACGTGG + Intronic
918714381 1:187768872-187768894 GGTCCTACACAGATGGGACGCGG + Intergenic
919476419 1:198037128-198037150 GGTCCTGCACAGATGGGACATGG - Intergenic
920050243 1:203160248-203160270 GGTCCCACACATTTTGGATAAGG - Intronic
920587288 1:207178811-207178833 CCTGCCACACAGATGGCACATGG + Intergenic
920901507 1:210114188-210114210 GGTCCCTCACAGATGGGACATGG + Intronic
920955623 1:210618170-210618192 GTTGGCACAGAGATGGGACATGG + Intronic
921212443 1:212911840-212911862 GGTCCCACACAGATGGGACGCGG - Intergenic
921459756 1:215413319-215413341 GGTCCCACACAGATGGGACGCGG + Intergenic
921509279 1:216010341-216010363 GGTCCGGCACAGATGGGACGTGG - Intronic
921520154 1:216147882-216147904 GGTCCCACACAGATGGGACGCGG - Intronic
921732949 1:218597168-218597190 GGTCCCACACAGATGGGATGCGG + Intergenic
922046444 1:221950266-221950288 GGTCCCACACAGACAGGACAAGG - Intergenic
922048435 1:221968290-221968312 GGTCCCGCACAGATGGGACACGG - Intergenic
922049509 1:221976482-221976504 GGTCCCGCACAGATGGGACGCGG + Intergenic
922154043 1:223027782-223027804 GGTCCCGCACAGATGGGACGCGG + Intergenic
922346472 1:224700698-224700720 GGGCCCAAACAGAAGGGACTGGG + Intronic
922598995 1:226835602-226835624 GGGCCTGCACAGATGGGACATGG - Intergenic
922906418 1:229176754-229176776 GGTCCCACACAGATGGGACGCGG - Intergenic
922934847 1:229414719-229414741 GGTCCCACACAGATGGGACATGG - Intergenic
923022352 1:230174841-230174863 TGTACCAGACAGATGGAACAAGG - Intronic
923075230 1:230603564-230603586 GGTCCCGCACAGATGGGACATGG - Intergenic
923214170 1:231833586-231833608 AGTCCCGCACAGATGAGACGCGG + Intronic
923244779 1:232120513-232120535 GGTCCCACACAGATGGGACGCGG - Intergenic
923257251 1:232232580-232232602 GGTCCCACATAGATGGGACGCGG + Intergenic
923770715 1:236935630-236935652 GGTCCCGCACAGATGGGACATGG + Intergenic
923962809 1:239103705-239103727 GGTCCCGCACAGATGGGACATGG - Intergenic
924180676 1:241436306-241436328 GGTCCTGCACAGATGGGACATGG - Intergenic
924896159 1:248339606-248339628 GGTCCTACACAGATGGGATATGG + Intergenic
1062930777 10:1351083-1351105 GGTCCTGCACAGATGGGACACGG - Intronic
1063106386 10:2996357-2996379 GGTCCCACACAGATGGGACATGG + Intergenic
1063168640 10:3486430-3486452 GGTCCCAGACAGAGGGGAATTGG - Intergenic
1063363190 10:5473446-5473468 GGTCCTGCACAGATGGGATGTGG - Intergenic
1064663791 10:17630221-17630243 GGTCCCGCACAGATGGGACACGG + Intergenic
1064886973 10:20122536-20122558 AGTCCCGCACAGATGGGACGCGG + Intronic
1065437655 10:25718781-25718803 GGTCCCACACAGACGGGATATGG - Intergenic
1065443095 10:25772116-25772138 GGTCCCACACAGATGGGACGCGG + Intergenic
1066103376 10:32137032-32137054 GGTCCTGCACAGATGGGACATGG + Intergenic
1066114146 10:32224956-32224978 GGTCCAAGAGAGATGTGACAAGG + Intergenic
1066437190 10:35405856-35405878 GGTCCTGCACAGATGGGACACGG + Intronic
1067360428 10:45573547-45573569 GGTCCCGCACAGATGGGACAAGG - Intronic
1067460772 10:46456768-46456790 GGACCTACACAGATGGGCGAGGG + Intergenic
1067626419 10:47927832-47927854 GGACCTACACAGATGGGCGAGGG - Intergenic
1068058326 10:52037141-52037163 GGTCCCACACAGATGGGACACGG + Intronic
1068179636 10:53502412-53502434 GGTCCCACACAGATGGGACACGG + Intergenic
1068230996 10:54169090-54169112 GGTCCCACACAGATGGGACGCGG - Intronic
1068360794 10:55973535-55973557 GGTCCCACACAGATGGGACATGG - Intergenic
1070474949 10:76820904-76820926 GGTCCCACAGAGATGGGACACGG - Intergenic
1070719179 10:78744679-78744701 GGACCCACACCCATGGGAAAGGG + Intergenic
1070987474 10:80700965-80700987 GGTCCCACACAGAGAGGGCAGGG + Intergenic
1071187256 10:83059483-83059505 GGTCCTGCACAGATGGGACATGG - Intergenic
1071550769 10:86564614-86564636 GGTCCCGCACAGATGGGACATGG + Intergenic
1071897712 10:90084417-90084439 GGTCTTACACAGATGGGACGCGG + Intergenic
1071916226 10:90297340-90297362 GGTCCCACACAGATGGGACGCGG - Intergenic
1072011253 10:91304864-91304886 GGTCCCGCATAGATGGGACATGG + Intergenic
1072580284 10:96734547-96734569 GGTCCCGCACAGATGGGACACGG - Intergenic
1073014039 10:100384080-100384102 GGTCTGGCACAGATGGGACATGG - Intergenic
1073394640 10:103207900-103207922 GTCCCTGCACAGATGGGACATGG - Intergenic
1073709468 10:106020996-106021018 GGTCCTTCACAGATGGGACGCGG + Intergenic
1073933226 10:108600137-108600159 GGTCCTGCACAGACGGGACTCGG - Intergenic
1074740800 10:116482988-116483010 GGTCCCGCACAGATGGGATGCGG - Intergenic
1075013506 10:118894286-118894308 GGGCCCACACAGACAGGGCATGG - Intergenic
1075248720 10:120847183-120847205 GGTCCCGCACAGATGGGACACGG - Intergenic
1076640239 10:131910934-131910956 GGGCCCACCCAGAGAGGACACGG + Intronic
1076700749 10:132271425-132271447 GGGCCCACACTGTTGGGACAAGG - Intronic
1076971364 11:135448-135470 AGACCCACACAGATGGGATTTGG - Intergenic
1077252571 11:1567088-1567110 GGTCACACACAGATGGGCACTGG + Intronic
1077353837 11:2105593-2105615 GGGCAGAGACAGATGGGACAGGG - Intergenic
1077589859 11:3483011-3483033 GGTCCCACACAGATGGGACATGG + Intergenic
1077612209 11:3650270-3650292 GGTCCCACACAGATGGGATACGG - Intronic
1077679046 11:4222622-4222644 GGTCTCGCACAGATGGGACACGG + Intergenic
1077688482 11:4319263-4319285 GGTCTCGCACAGATGGGACACGG + Intergenic
1077766360 11:5163661-5163683 GGTCCTGCACAGATGGGACACGG + Intronic
1077883380 11:6368148-6368170 GGTCCTGCACAGATAGGACATGG - Intergenic
1079447483 11:20570123-20570145 GGTCCCACAGAGATGGGACATGG - Intergenic
1079727052 11:23890559-23890581 GGTCCTGCACAGATGGGACATGG + Intergenic
1079847666 11:25490596-25490618 GGTCCCGCACAGATGGGACGTGG + Intergenic
1080027893 11:27632461-27632483 GGTCCCACACAGATGGGACACGG + Intergenic
1080994431 11:37581997-37582019 TGTCCTGCACAGATGAGACATGG + Intergenic
1081159726 11:39736740-39736762 GTCCCTGCACAGATGGGACACGG - Intergenic
1081356830 11:42122910-42122932 GGTCCCACACAGATGGGACGCGG - Intergenic
1081677867 11:44981409-44981431 GCACCCACAGAGCTGGGACAAGG + Intergenic
1081993147 11:47348206-47348228 AGTCCCACCCAGATGAGACCCGG + Intronic
1082197740 11:49324810-49324832 GGTCCTGCACAGATGGGACATGG + Intergenic
1082634872 11:55583586-55583608 GGTCCTCCACAGAGGGGGCATGG - Intergenic
1083534434 11:63455244-63455266 GGTCCTTCACAGATGGGACATGG - Intergenic
1083726691 11:64632108-64632130 GGTGGCTCACAGATGGGGCAAGG + Intronic
1083876687 11:65527818-65527840 GGTCCCAAACATTTTGGACAAGG + Intronic
1084047189 11:66575953-66575975 GGTCCCACACAGGTGGGACACGG - Intergenic
1084153669 11:67302739-67302761 GGTCCCCAGCAGGTGGGACAGGG - Intergenic
1084245576 11:67854785-67854807 GGTCCCGCACAGATGGGACATGG + Intergenic
1084613258 11:70217684-70217706 GGTCCTGTACAGATGGGACATGG + Intergenic
1084827112 11:71739793-71739815 GGTCCCACACAGATGGGACATGG - Intergenic
1085570216 11:77552267-77552289 GGTCCTGCACAGATGGGACATGG - Intronic
1085934290 11:81124158-81124180 GGTCCTGCACAGATGGGATGTGG - Intergenic
1085988039 11:81808549-81808571 GGTCCCACACAGATGGGAAATGG - Intergenic
1086005044 11:82027555-82027577 GGTCCCGCACAGATGGGACATGG - Intergenic
1086125285 11:83343461-83343483 GATCCCACACAGATGGGACATGG + Intergenic
1086133172 11:83421458-83421480 GGTCCTATACAGATGGGACATGG - Intergenic
1086134810 11:83434961-83434983 GGTCCTGCACAGATGGGACATGG + Intergenic
1086136246 11:83446278-83446300 GGTCCTGCACAGATGGGACATGG + Intergenic
1086514540 11:87596565-87596587 GGACACCCACAGATGGGAAAGGG + Intergenic
1086550237 11:88045526-88045548 GGTCCTGCACAGATGGGACATGG - Intergenic
1086658080 11:89383317-89383339 GGTCCCGCATAGATGGGACATGG - Intronic
1087049005 11:93867691-93867713 GGTCCTCCACAGAAGGGGCATGG + Intergenic
1087099122 11:94348054-94348076 GGTCCTGCACACATGGGAGATGG - Intergenic
1087127838 11:94643951-94643973 GGTCCTGCACAGATGGGACACGG - Intergenic
1087314699 11:96590258-96590280 GGTCCCACAAAGATGGGACGCGG - Intergenic
1087459675 11:98430123-98430145 GGTCCCAAACACCTGGGCCACGG + Intergenic
1087839517 11:102907456-102907478 GGTCCCACACAGATGGGACGCGG + Intergenic
1088554984 11:111052527-111052549 GGTCCTGCACAGATGGGACATGG - Intergenic
1089349115 11:117811616-117811638 GGTCCCGCGCAGATGGGACACGG - Intronic
1089471032 11:118720376-118720398 GGTCCCGCGCAGATGGGACACGG + Intergenic
1089753270 11:120667045-120667067 GGGGCCACACAGGTCGGACAGGG + Intronic
1089867024 11:121641301-121641323 GGTCCCACACAGATGGGACACGG + Intergenic
1089953322 11:122549286-122549308 GTCCCTGCACAGATGGGACATGG - Intergenic
1089987706 11:122829457-122829479 GGTCCTGCACAGATGGGATGTGG - Intergenic
1090107575 11:123868975-123868997 GGTCCTGCACAGATGGGATGTGG + Intergenic
1090526786 11:127546109-127546131 GGTCCTGCACAGATGGGACATGG + Intergenic
1090546466 11:127772453-127772475 GGTCCTGCACAGATGGGACATGG + Intergenic
1090850572 11:130567741-130567763 GGTCCCGCACAGATGGGATGCGG + Intergenic
1090871936 11:130756887-130756909 GGTCCTGCACAGATGGGACATGG + Intergenic
1090926914 11:131257866-131257888 GGTCCTGCACAGATGGGATGCGG + Intergenic
1091886543 12:4020865-4020887 GGTCCCGCACAGATGGGACGCGG - Intergenic
1092164416 12:6334172-6334194 GGTCCCTCACCTAGGGGACAGGG - Exonic
1092416153 12:8291916-8291938 GGTCCCGTACAGATGGGACATGG + Intergenic
1092474506 12:8807271-8807293 GGTCCTGCACAGATGGGACACGG - Intergenic
1092592734 12:9966444-9966466 GGTCTTGCACAGATGGGACATGG + Intronic
1092626725 12:10336306-10336328 TGTCCTACACAGATGGGACGTGG + Intergenic
1092723698 12:11465547-11465569 GGTCCCACACAGATGGGACGCGG + Intronic
1092739301 12:11613072-11613094 GGTCCCGCACAGATGGGACATGG + Intergenic
1092789730 12:12060727-12060749 GGTCCCGCACAGATGGGACACGG - Intronic
1093024355 12:14232914-14232936 GGTCCCGCACAGATGGGACACGG - Intergenic
1093071141 12:14708251-14708273 GGTCCCACACAGATGGGACGCGG + Intergenic
1093267986 12:17025081-17025103 GGTCCCACACAGATGGGACATGG + Intergenic
1093302253 12:17471884-17471906 GGTCCCACACAGATGGGACACGG - Intergenic
1093321963 12:17723652-17723674 GGTCCCACACAGATGGGACGTGG + Intergenic
1093343929 12:18016814-18016836 TATCCCACACAGATGAGAAAGGG + Intergenic
1093358459 12:18197285-18197307 GGTCCTGTACAGATGGGACATGG - Intronic
1093578838 12:20765711-20765733 GGTCCCACACAGATGGGACATGG - Intergenic
1093584496 12:20820379-20820401 GGTCCCACACAGATGGGACACGG + Intronic
1093812814 12:23509389-23509411 GGTCCTGCACAGATGGGACACGG + Intergenic
1094316028 12:29138379-29138401 GGTCCCACACAGATGGGTCATGG + Intergenic
1094359197 12:29611787-29611809 TGTTTCACACAGATGGGGCAGGG + Intronic
1094400701 12:30058312-30058334 GGTCCCACACAGATGGGACATGG - Intergenic
1095637676 12:44452131-44452153 GGTCCCACACAGATGGGACATGG - Intergenic
1095778161 12:46032193-46032215 GGTCCCACACAGATGGGACACGG - Intergenic
1095985360 12:47995671-47995693 GCTCCCCCAGAGAAGGGACAGGG + Intronic
1095999002 12:48113508-48113530 GGTCCCGCACAGATGGGACATGG + Intronic
1096176982 12:49528271-49528293 CCACCCAGACAGATGGGACAAGG + Intergenic
1097398611 12:59104174-59104196 TGTCCCGCACAGATGGGACACGG - Intergenic
1097417031 12:59326596-59326618 GGTCCCACACAGATGGGACGTGG + Intergenic
1097542177 12:60955360-60955382 GGTCCCACACAGATGGGACGTGG + Intergenic
1098173618 12:67770025-67770047 GGTCCTACACAGATGGGACACGG + Intergenic
1098402274 12:70087735-70087757 GGTCCCACACAGATGGGACGCGG - Intergenic
1098629081 12:72705684-72705706 GGTCCCACAAAGATGGGACGTGG - Intergenic
1098630011 12:72712271-72712293 GGTCCCGCAGAGATGGGACGCGG + Intergenic
1098653805 12:73005341-73005363 GGTCCTGCACAGATGGGACGTGG + Intergenic
1098919926 12:76293794-76293816 GGTCCTGCACAGATGGGACATGG - Intergenic
1099188739 12:79542194-79542216 GGTCCCACACAGATGGGACACGG - Intergenic
1099292080 12:80786455-80786477 GGTCCCACACAGATGGGACGCGG + Intergenic
1099477554 12:83125560-83125582 GGTCCCAAACATTTTGGACAAGG - Intronic
1099762609 12:86941134-86941156 GGTCCCACACAGATGGGACGCGG - Intergenic
1099836078 12:87910768-87910790 GGTCCTGCACAGATGGGACACGG + Intergenic
1100031054 12:90191625-90191647 GGGCCCACACATATAGGAGAGGG - Intergenic
1100178537 12:92058812-92058834 GGGCCCACACAGAGTGGCCAAGG - Intronic
1100561382 12:95751511-95751533 GGTCCCACACAGATGGGATGCGG - Intronic
1100940321 12:99717522-99717544 GGTCCCACACAGATGGGACGCGG - Intronic
1101077428 12:101145812-101145834 GGTCCCACACAGATGGGACATGG - Intergenic
1101278375 12:103226057-103226079 GGTCCCACACAGATGGGACGTGG + Intergenic
1101391892 12:104308746-104308768 GGTAGCACAGAGATGGGATAAGG - Intronic
1102289827 12:111690164-111690186 GGTTCCAAACATTTGGGACAAGG - Intronic
1102688553 12:114742610-114742632 GGACCCACACAGATGGGGCAGGG + Intergenic
1103172752 12:118835661-118835683 GGAAACACACAGAAGGGACACGG + Intergenic
1103231531 12:119334981-119335003 GGTCTCCCACAGACGGGATAAGG - Exonic
1103875396 12:124123278-124123300 CCACCCCCACAGATGGGACAAGG + Intronic
1104257627 12:127154128-127154150 GTCCCTGCACAGATGGGACAGGG - Intergenic
1104460889 12:128954945-128954967 GGTCCCAGGAAGAGGGGACAGGG - Intronic
1105032235 12:132892043-132892065 GTCCCTGCACAGATGGGACACGG - Intronic
1105303520 13:19154418-19154440 GGCACCACACAGGTGGGACAGGG + Intergenic
1105704536 13:22960975-22960997 GGTTCCCCACTGCTGGGACAGGG - Intergenic
1106541771 13:30696933-30696955 AGTCCCACACAGATGGGCCTGGG + Intergenic
1106943463 13:34800978-34801000 GGTCCCGCACAGATGGGACACGG - Intergenic
1107075602 13:36318777-36318799 GGTCCCACACAGATGGGACGGGG - Intronic
1107220274 13:37972553-37972575 GGTCCCACACAGATGAGACACGG + Intergenic
1107232506 13:38127356-38127378 GGACCCACACAGGTGGGGAAAGG + Intergenic
1107683118 13:42870795-42870817 GGTCCCACACAGATAGGACACGG + Intergenic
1108282044 13:48870500-48870522 GGTGCCACACAGATGGGACATGG + Intergenic
1108513017 13:51172202-51172224 GGTCCCACACAGATGGGACGCGG - Intergenic
1108814147 13:54269191-54269213 GGTGCCACACAGATGGGACGCGG - Intergenic
1108913397 13:55581622-55581644 GGTCCCACACAGATGGGACGCGG + Intergenic
1108919523 13:55658351-55658373 GGTCCCACACAGATGGGACACGG + Intergenic
1108947457 13:56042646-56042668 GGTCCCACACAGATGGGACGTGG - Intergenic
1109343601 13:61090691-61090713 GGTCTTGCACAGATGGGACATGG - Intergenic
1109352936 13:61207122-61207144 GGTCTTGCACAGATGGGACATGG - Intergenic
1109499313 13:63215458-63215480 GGTCCTGCACAGATGGGACACGG - Intergenic
1109709643 13:66144714-66144736 GGTCCCACACAGGTGGGACGCGG + Intergenic
1109716719 13:66229758-66229780 GGTCCCACACAGATGGGACGTGG + Intergenic
1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG + Intergenic
1110650464 13:77936697-77936719 GGTCCTGCACAGATGGGACATGG + Intergenic
1110765499 13:79276470-79276492 GGTCCCGCACAGATGGGAGGTGG - Intergenic
1110845366 13:80186007-80186029 GGTCCCACACAGATGGGACATGG - Intergenic
1110978514 13:81868509-81868531 GGTCCTGCACAGAGGGAACATGG - Intergenic
1111126020 13:83911658-83911680 GGTCCTACACAGATGGGATGCGG + Intergenic
1111302070 13:86360741-86360763 GGTCCCACACAGATGGGACGCGG - Intergenic
1111362084 13:87189804-87189826 GGTCCCACACAGATGGGATATGG + Intergenic
1111458815 13:88516202-88516224 GGTCCCACACAGATGGGACAAGG + Intergenic
1111630465 13:90841775-90841797 GGTCCCACACAGATGGGACGTGG - Intergenic
1111631681 13:90851964-90851986 GGTCCGGCACAGATGGGACGTGG + Intergenic
1111707418 13:91767810-91767832 TGTGCCAAACAGATGGGAAAAGG - Intronic
1112236853 13:97644651-97644673 GGTCCCACACAGATGGGATGCGG - Intergenic
1112541270 13:100315749-100315771 TTTCCCATACAGATGGGACCTGG + Intronic
1112889294 13:104211434-104211456 GGTCCTGCACAGATGGGACGTGG + Intergenic
1113177013 13:107576594-107576616 GGTCACATACATATGGGTCAAGG + Intronic
1113324359 13:109267683-109267705 GGTCCCGCACAGATGGGACATGG - Intergenic
1113897367 13:113774419-113774441 GGTCCCACAGGGATGGGAAAGGG + Intronic
1114221699 14:20702918-20702940 GGTCCCGCACAGATGGGACATGG - Intergenic
1115240582 14:31248720-31248742 GGTCCCGCACAGATGGGACACGG + Intergenic
1115904833 14:38193126-38193148 GGTCCCACACAGATAGGACGTGG - Intergenic
1116179702 14:41518278-41518300 GGTCCCACACAGATGGGACGCGG - Intergenic
1116490560 14:45498761-45498783 GGTCCCGCCCAGATGGGACGAGG + Intergenic
1116573476 14:46546262-46546284 GGTCCCACACAGATGGGACATGG - Intergenic
1116613536 14:47106516-47106538 GGTCCCGCACAGATGGGACGCGG - Intronic
1116702383 14:48258759-48258781 GGTCCCGCACAGATGGGACACGG + Intergenic
1116703268 14:48265751-48265773 GGTCCTGCACAGATGGGACATGG + Intergenic
1116952936 14:50895506-50895528 GGTCCCAGAGAGATGGGACGCGG - Intronic
1117790230 14:59332601-59332623 GGTACCACACAGATGTGACTGGG - Intronic
1117801204 14:59446391-59446413 GGTCCTGCACAGATGGGACGTGG - Intronic
1118937234 14:70299179-70299201 GTCCCTGCACAGATGGGACATGG + Intergenic
1119022453 14:71126661-71126683 GATCCTGCACAGATGGGACATGG - Intergenic
1119031541 14:71196720-71196742 ATTCCCAAACAGATGAGACATGG - Intergenic
1119720094 14:76884663-76884685 TGTCCCTCACAGTTGGGCCAGGG + Intergenic
1119851543 14:77870015-77870037 GGACCAACACAGATGGGTAAAGG + Intronic
1120438030 14:84503582-84503604 GTTCCCGCACAGATGGGACGCGG + Intergenic
1120539537 14:85736350-85736372 GCTCCCGCACAGATGGGACATGG + Intergenic
1120618278 14:86733684-86733706 GATCCTGCACAGATGGGACATGG - Intergenic
1120659932 14:87238414-87238436 GGTCCCGCACAGATGAGACATGG + Intergenic
1121193277 14:92048086-92048108 GGTCCTGCACAGATGGGACATGG + Exonic
1121560178 14:94868695-94868717 TGTGCCCAACAGATGGGACAGGG - Intergenic
1121980562 14:98450501-98450523 GGTCCGGCAGAGATGGGACACGG + Intergenic
1122041019 14:98987534-98987556 GGTCCCACACAGATGGGACGCGG - Intergenic
1122101275 14:99412275-99412297 GGTCCCCCACAGCTGGGAAGAGG - Intronic
1122381299 14:101309048-101309070 GGTCCCACACAGATGGGACACGG + Intergenic
1122426060 14:101606227-101606249 GCTCATCCACAGATGGGACATGG + Intergenic
1122507656 14:102241963-102241985 GGTCCTGCACAGATGGGACATGG - Intronic
1123882472 15:24688956-24688978 GGTCCCGCATAGATGGGACATGG + Intergenic
1125045798 15:35241105-35241127 GGTCCCGCACAGATGGGACACGG - Intronic
1125131493 15:36289018-36289040 GGTCCCGCACAGATGGGACGCGG + Intergenic
1125213194 15:37239572-37239594 GGTCCCACACAGATGGGACGCGG + Intergenic
1125828880 15:42697835-42697857 GGTCCCACACATTTTGGAGAAGG + Intronic
1126530130 15:49702513-49702535 GGTCCCACACAGATGGGATGTGG + Intergenic
1126843769 15:52740922-52740944 GGTCCCGCACAGACGGGACACGG - Intergenic
1126912383 15:53430209-53430231 GGTCCCGCACAGATGGGACATGG + Intergenic
1127349899 15:58140878-58140900 GGTCCCCAACACATGGGCCACGG + Intronic
1127834911 15:62783270-62783292 GGTCCCACCCAGGTGAGAGAGGG - Intronic
1129259456 15:74356264-74356286 GGTCCTGCACAGATGGGACATGG - Intronic
1129878159 15:78990444-78990466 GGGGCCACACAGCTGCGACAAGG - Intronic
1130304571 15:82704587-82704609 GGTTCCACACAGATGGGACAAGG - Intronic
1130781089 15:87041986-87042008 GGTCCTGCACAGATGGGACACGG - Intergenic
1130855134 15:87833602-87833624 GGTCCCACACAAATGGGACGCGG - Intergenic
1131312260 15:91301691-91301713 GGTCCCAAACATTTGGGATAAGG - Intergenic
1131447771 15:92513846-92513868 GGTCCTGCACAGGTGGGACACGG - Intergenic
1131684203 15:94753109-94753131 GGACCTGCACAGATGGGACATGG - Intergenic
1131684729 15:94756807-94756829 GGTCCTGCAGAGATGGGACACGG - Intergenic
1131882493 15:96875201-96875223 GGTCCCACACAGATGGGACGTGG + Intergenic
1132263036 15:100442622-100442644 GGTCCCGCATAGACAGGACACGG - Intronic
1132340435 15:101074872-101074894 GGTCCCGCACAGATGGGACACGG - Intronic
1133226516 16:4343334-4343356 GGGCCCACAGAGATGGGCCCTGG + Intronic
1133765712 16:8836390-8836412 GGTCCCGCACAGATGGGACGCGG + Intronic
1133766742 16:8843456-8843478 GGTCCCGCACAGATGGGACACGG + Intronic
1133869521 16:9674490-9674512 GGTCCCACACAGATGGGACGTGG + Intronic
1134342157 16:13355945-13355967 GGTCCCACAGAGATGGGACGTGG + Intergenic
1135025391 16:18995506-18995528 GGTCCCACACAGATGGGACACGG + Intronic
1135177954 16:20247824-20247846 GGCCCTCCACAGATGGGATAAGG - Intergenic
1136481588 16:30545371-30545393 GGTCCTCCACAGAGGGGGCATGG + Intronic
1136529975 16:30861492-30861514 GATCCCACACAGATGGGACACGG - Intronic
1136995492 16:35186006-35186028 TGTCCCTCACAGGTGGGGCAGGG - Intergenic
1137696314 16:50464508-50464530 GGACACACACAGCTGGTACATGG + Intergenic
1138533426 16:57647172-57647194 GTTGCCACACAGATTGGGCAGGG - Intronic
1138759078 16:59521005-59521027 GGTCCCGCACAGATGGGACACGG + Intergenic
1138804971 16:60081168-60081190 GGTCACACACAGATGGGACGCGG - Intergenic
1139039214 16:62982520-62982542 GGTCCTGCACACATGGGACACGG + Intergenic
1139225892 16:65233209-65233231 GGTCCCACACAGATGGGACGCGG + Intergenic
1139230576 16:65278626-65278648 GGTCCCACACAGATGGGACGCGG + Intergenic
1139434427 16:66927848-66927870 GGTCCTACAGAGAGGAGACATGG - Intergenic
1139943028 16:70619841-70619863 GGTCCCACACAGATGGGACGCGG + Intronic
1139943696 16:70624158-70624180 GGTCCCACACAGATGGGACGCGG + Intronic
1141604234 16:85143895-85143917 TGTCTCTCACAGATGGGCCACGG - Intergenic
1141865183 16:86745398-86745420 GGTCCCGCACAGATGGGACACGG + Intergenic
1141898062 16:86971367-86971389 GCTGCCAAACAGCTGGGACATGG - Intergenic
1142161855 16:88561919-88561941 GGTCCCACACAGAACAGACAGGG + Intergenic
1142183071 16:88681083-88681105 GCACCCACACAGGTAGGACAGGG - Exonic
1142275696 16:89117770-89117792 AGCCCCAGACAGATGGCACAGGG + Intronic
1142448887 16:90162074-90162096 AGACCCACACAGATGGGATTTGG + Intergenic
1142449289 16:90165493-90165515 AGACCCACACAGATGGGATTTGG + Intergenic
1142467748 17:145842-145864 GGCCCCACACAGCTGGAACCAGG - Intergenic
1143611438 17:8020143-8020165 GGTCCACTGCAGATGGGACAGGG - Exonic
1143794615 17:9326694-9326716 ATTCCAACACAGAAGGGACATGG + Intronic
1143847206 17:9781560-9781582 TGTTCCACACAGGTGGGGCAAGG - Exonic
1144104694 17:11974231-11974253 GGTCCCGTACAGATGGGACACGG - Intergenic
1145080643 17:19891836-19891858 GGTCCCACACAGATGGGACGTGG + Intergenic
1146447561 17:32944466-32944488 GGGCACACAGAGAAGGGACAGGG + Intronic
1146597921 17:34185610-34185632 GGTCCCACACAGATGGGACGCGG - Intergenic
1148123819 17:45226815-45226837 GGGTCCCCACAGCTGGGACAAGG - Intronic
1149220527 17:54411793-54411815 GGTCCCTCACAGATGGGACATGG - Intergenic
1149319589 17:55470135-55470157 GGACCTGCACAGATGGGACATGG - Intergenic
1151389284 17:73774870-73774892 GGACCCAGCGAGATGGGACAAGG + Intergenic
1151839732 17:76609328-76609350 GGTCCCGCACAGATGGGACACGG + Intergenic
1152000021 17:77639472-77639494 GGTCTTCCACTGATGGGACAAGG - Intergenic
1152126699 17:78451409-78451431 CGTCCCACACAGAGGGGGCCAGG - Intronic
1155696995 18:28696474-28696496 GGTCCCGCACAGATGGGACACGG + Intergenic
1155941572 18:31806141-31806163 GGTCCCACACAGATGGGATGTGG - Intergenic
1156237381 18:35218105-35218127 GGTACTGCACAGATGGGACATGG - Intergenic
1156251909 18:35359682-35359704 GGTCCCGCACAGATGGGATATGG + Intergenic
1156302271 18:35846230-35846252 GGTCCCACACAGATGGGACATGG - Intergenic
1156729007 18:40167047-40167069 GGTCCATCACAGATGGCATATGG + Intergenic
1156915831 18:42463905-42463927 GGTCCTGTGCAGATGGGACACGG - Intergenic
1156958202 18:42993210-42993232 GGTCCCACATAGACAGGACGTGG - Intronic
1157528166 18:48400906-48400928 GGCCACACAAAGATGGGGCACGG - Intronic
1157906367 18:51573412-51573434 GGTCCCACACAGATGGAACGCGG + Intergenic
1158055421 18:53273855-53273877 GGTGCCTCACAGATGTGCCAGGG - Intronic
1158394623 18:57070000-57070022 GGTCCTGCACAGATGGGACACGG + Intergenic
1158441619 18:57479822-57479844 TGGCACACCCAGATGGGACAGGG - Exonic
1159164487 18:64683977-64683999 GGTCCCGCACAGATGGGACATGG - Intergenic
1159835075 18:73326973-73326995 GGTCCCACACAGATGGGACGCGG - Intergenic
1160223369 18:76992959-76992981 GGTTTCAGACAGATGGGAGAAGG - Intronic
1160741252 19:687102-687124 GGCCCCCCACAGCGGGGACACGG - Exonic
1161245589 19:3249855-3249877 GGTCCCAGAAAGATGGAAGAAGG - Intronic
1161661743 19:5550807-5550829 GGTCCCACACAGATGGGACGCGG - Intergenic
1161711240 19:5849426-5849448 GGTCCTTCACAGATGGGACATGG - Intronic
1161712062 19:5854446-5854468 GGTCCTGCACAGATGGGACACGG - Intergenic
1162262232 19:9542572-9542594 GGGGTCCCACAGATGGGACATGG - Intergenic
1163469251 19:17487147-17487169 GGTCCCCAACACATGGGTCATGG - Intronic
1163487312 19:17595765-17595787 GGTCCCACACAGATGGGATACGG - Intergenic
1163532044 19:17855721-17855743 GGGCCACCGCAGATGGGACATGG + Intergenic
1163580281 19:18134806-18134828 CGTCCCACACACCTGGGCCAGGG - Exonic
1163900199 19:20093998-20094020 GTCCCTGCACAGATGGGACATGG + Intronic
1163944431 19:20522454-20522476 GGTCCCGCACAGATGGGACATGG + Intergenic
1164004068 19:21133149-21133171 GGTCCTGCTCAGATGGGACATGG + Intergenic
1164080827 19:21860138-21860160 GGTCCCACACAGATGAGACAGGG - Intergenic
1164202481 19:23030194-23030216 GGTCCCACACAGATGGGACATGG + Intergenic
1164258785 19:23551600-23551622 GGTCCTGCACAGATGGGACACGG - Intronic
1164459204 19:28433236-28433258 GGTCCCCCACAGATGGGACATGG + Intergenic
1165087979 19:33364584-33364606 GGTGCCCAACAGATGAGACAGGG - Intergenic
1165249258 19:34516330-34516352 GGTCCCACACAGATGGGACATGG - Intergenic
1165496986 19:36158791-36158813 GGTCCTGCACAGATGGGACACGG + Intergenic
1165510299 19:36262857-36262879 GTTCCTGCACAGATGGGACATGG + Intergenic
1165835380 19:38751947-38751969 GGTCCTGCACAGATGGGACACGG - Intronic
1165893864 19:39130166-39130188 GGACCCAGGCAGATGGGTCATGG + Intronic
1166498917 19:43326876-43326898 GGTCCCACACAGATGGGACGCGG + Intergenic
1166905772 19:46107423-46107445 GGGTCCGCACAGATGGGACATGG + Intergenic
1167046579 19:47053120-47053142 GGTCCCACACAGATGGGACGCGG + Intergenic
1167099479 19:47395383-47395405 GTCCCTGCACAGATGGGACATGG - Intergenic
1167902172 19:52630108-52630130 GGTCCCACACAGATGGGACACGG - Intronic
1168051664 19:53833946-53833968 GGTCCCACACAGATGGGACGCGG - Intergenic
1168212096 19:54898259-54898281 GGTCCCGCACAGATGGGATGCGG + Intergenic
1168227965 19:55010157-55010179 GGTCCCGCACAGATGGGACACGG + Intergenic
1168327559 19:55545999-55546021 CGACCCACAGAGACGGGACAGGG - Intergenic
925433835 2:3819277-3819299 GGTCCTGCACAGATGGGACGTGG + Intronic
925544574 2:5003316-5003338 GTTCCCACACAGATGGGACACGG - Intergenic
925828797 2:7876035-7876057 GGTCCCACACAGATGGGACTCGG + Intergenic
925900514 2:8506050-8506072 CGACCCACACAGAGAGGACAGGG - Intergenic
926199196 2:10781093-10781115 GGTGCCACAGAGACAGGACAGGG + Intronic
926464071 2:13167364-13167386 GGTCCTACACAGATGGGACGTGG + Intergenic
926815525 2:16795315-16795337 GGTCCCACACAGATGGGACGTGG + Intergenic
928211804 2:29329064-29329086 GGCCACACAGAGAAGGGACATGG - Intronic
928770199 2:34696189-34696211 GGTCCCGCACAGATGGGACACGG - Intergenic
928827633 2:35440471-35440493 GGTCCCGCACAGATGAGACATGG + Intergenic
928857193 2:35815417-35815439 GGTCCCGCACAGATGGGACATGG - Intergenic
928928586 2:36601372-36601394 GGTCCCGCACAGATGGGACACGG - Intronic
929076654 2:38084139-38084161 GGTCCCACACAGATGGGACATGG + Intronic
929383559 2:41380270-41380292 GTCCCTGCACAGATGGGACATGG - Intergenic
929684505 2:44022417-44022439 GGTCCCACACAGATGGGACACGG + Intergenic
929793043 2:45037809-45037831 GGTCCCGCACAGATGGGACATGG + Intergenic
930487342 2:52025487-52025509 GGTCCCACACAGATGGGACACGG + Intergenic
930955119 2:57195303-57195325 GGTCCCACACAGATGGGACACGG - Intergenic
931026371 2:58116789-58116811 GGTCCCGCACAGATGGGACACGG + Intronic
931608905 2:64078543-64078565 GGTCCTGCACAGATGGGACACGG + Intergenic
931625801 2:64254865-64254887 GGTCCCACACAGATGGGACACGG - Intergenic
931850444 2:66246268-66246290 GGTCCTGCACAGATGGGACGCGG - Intergenic
931948278 2:67333934-67333956 GGTCCTGCACAGATGGGACACGG - Intergenic
932159438 2:69447025-69447047 GGTCCCACACAGATGGGACATGG + Intergenic
932295875 2:70622964-70622986 GGTCCTACACAGATGGGACGTGG - Intronic
932358798 2:71088417-71088439 GGTCCCGCACAGATGGGACACGG + Intergenic
932367625 2:71163057-71163079 GGTCCTGCACAGATGGGACGCGG + Intergenic
932854189 2:75217166-75217188 GGTCCTACACAGATGGGACGCGG + Intergenic
932947643 2:76255509-76255531 ACACCCACACAGATGGTACAGGG - Intergenic
932973934 2:76577227-76577249 GGTCCCACACAGATGGGACGCGG + Intergenic
933079290 2:77967446-77967468 GGTCCCGCACAGATGGGACATGG - Intergenic
933137956 2:78760234-78760256 GGTCCCTCACAGATGGGACATGG - Intergenic
933179749 2:79215192-79215214 GGTCCTGCACAGATGGGACGTGG + Intronic
933329499 2:80877840-80877862 GGTCCTACACAGATGGGACGTGG + Intergenic
933552371 2:83792283-83792305 GGTCCCGCACAGATGGGACACGG + Intergenic
934141283 2:89050256-89050278 GGTCCTGCACAGATGGGACACGG - Intergenic
934227957 2:90150288-90150310 GGTCCCGCACAGATGGGACACGG + Intergenic
936794270 2:116187642-116187664 GGTCCCACACAGATGGGATGGGG + Intergenic
936883357 2:117281078-117281100 GGTCCCACACAGATGGGACGCGG - Intergenic
939083117 2:137686317-137686339 GGTCCTACACAGATGGGATGTGG + Intergenic
939307436 2:140428476-140428498 GGTCCCGCACAGATGGGAAGCGG - Intronic
939460716 2:142493212-142493234 GGACCCATACAGATGGGACATGG + Intergenic
940182962 2:150955376-150955398 GGTCCCACACCGATGGGACATGG - Intergenic
940216846 2:151311167-151311189 GGTCCCACACAGATGGGACATGG - Intergenic
940508767 2:154586611-154586633 GGTCCCGCACAGATGGGACATGG + Intergenic
940530209 2:154869658-154869680 GGTCCCGCACAGATGGGACACGG - Intergenic
940675782 2:156723442-156723464 GGTCCTGCACGGATGGGACACGG + Intergenic
940726418 2:157341478-157341500 GTTCCCACACAGATGGGACATGG + Intergenic
941340421 2:164298192-164298214 GGTCCCGCACAGATGGGACACGG - Intergenic
941353405 2:164461447-164461469 GGTCCCGCACAGGTGGGATGCGG - Intergenic
941707935 2:168679648-168679670 GCTCACACACAGATAGGACATGG + Intronic
941935871 2:170981012-170981034 GGTCCTGCACAGATGGGACACGG + Intergenic
942730270 2:179055129-179055151 GGTCCTTCACAGATGGGACACGG + Intergenic
943061592 2:183046223-183046245 AGTCCTGCACAGATGGGACGAGG - Intergenic
943412910 2:187563852-187563874 GGTCCCACACAGTTGGGACACGG + Intronic
943421564 2:187673851-187673873 GGTCCCGCACAGATGGGACATGG + Intergenic
943450147 2:188035545-188035567 GGTCCCGCACAGACAGGACACGG - Intergenic
943461173 2:188172578-188172600 GGTCCCGCACAGATGGGACGTGG + Intergenic
943806670 2:192132759-192132781 GGTCCTGCACAGATGGGACATGG - Intronic
943835423 2:192509817-192509839 GGTCCTACACAGATGGGACATGG - Intergenic
943865364 2:192920396-192920418 GGTCCTGCACAGATGGGACATGG - Intergenic
944251055 2:197580450-197580472 GGTCCTGCACAGATGGGATATGG - Intronic
944394162 2:199249262-199249284 GGTCCCACACAGATGGGACGCGG - Intergenic
944876110 2:203965290-203965312 GGTCCCGCACAGATGGGACGCGG + Intergenic
945153080 2:206810231-206810253 GGTCCCACACAGTTGGGACGCGG + Intergenic
945173482 2:207019584-207019606 GGTCCCACACAGATGGGACATGG - Intergenic
945301459 2:208219610-208219632 GGTCCTGCACAGATGGGACATGG + Intergenic
945376123 2:209080408-209080430 GGTCCCACACAGATGGGACGCGG - Intergenic
945394325 2:209301560-209301582 GGTCCCACACAGATGGGACGCGG - Intergenic
945554708 2:211263805-211263827 GGTTCCACACAGATGGGACACGG - Intergenic
945559951 2:211327560-211327582 CCTCCCAGACACATGGGACAGGG + Intergenic
945938342 2:215924708-215924730 GGTCCCACACAGATGGGACGTGG - Intergenic
946215011 2:218177405-218177427 CATCCTGCACAGATGGGACACGG + Intergenic
946590958 2:221246577-221246599 GGTACCACACAGCCGGGGCAGGG + Intergenic
946781023 2:223193214-223193236 GGTCCCACACAGATGGGACATGG + Intronic
946871735 2:224091224-224091246 GGTCCCGCACAGATGGGACATGG + Intergenic
946886518 2:224227627-224227649 GGTCCTGCACAGATGGGACATGG - Intergenic
946893294 2:224299012-224299034 GGTCCCGCACAGATGGGACGCGG - Intergenic
947740881 2:232484334-232484356 AGCCCCACAAAGAAGGGACAGGG + Intronic
948134671 2:235627844-235627866 GGCCAAACAGAGATGGGACAAGG + Intronic
948390706 2:237609292-237609314 GGTCCCGCAAAGATGGGACGCGG - Intergenic
948720774 2:239898772-239898794 AGTCCTACACAGATGGGGCAAGG + Intronic
948930348 2:241127967-241127989 GGGCCCACACAGAAGGGGCCAGG + Intronic
1168839284 20:898880-898902 GGTCCCGCAAAGATGGGACACGG - Intronic
1169661150 20:7979800-7979822 GGTCCCACACATTTTGGATAAGG - Exonic
1170068846 20:12343649-12343671 GGTCCGACACAGATGGGACGCGG + Intergenic
1170106256 20:12756209-12756231 GGTCCCACACAGATGGGACGCGG - Intergenic
1170165763 20:13359298-13359320 GGTCCCACACAGATGGGATGCGG - Intergenic
1170325467 20:15151207-15151229 GGTCCCACAGAGATGGGACGCGG + Intronic
1170680413 20:18520971-18520993 GGTCCCGCACAGATGGGACACGG + Intronic
1170820681 20:19754519-19754541 GGTCCCGCACAGATGGGACACGG + Intergenic
1171279410 20:23883361-23883383 GGTCCCCCACAGTTGGGAGCAGG - Intergenic
1172808897 20:37633198-37633220 GCTCCCACACCTCTGGGACAGGG - Intergenic
1173101936 20:40095685-40095707 GGTCCCACACAGATGGGACACGG - Intergenic
1173168491 20:40703296-40703318 GGCCCCACAGAGATGGGACTGGG + Intergenic
1173348022 20:42218795-42218817 TGTCCCACACAGCCGGGCCAGGG - Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1177100646 21:16894513-16894535 GATCCCACACAGATGGGACATGG - Intergenic
1177102696 21:16916325-16916347 GGTCCCGCACAGATGGGACATGG - Intergenic
1177119590 21:17123830-17123852 CATCCCACACAGATGGGACATGG - Intergenic
1179015260 21:37590384-37590406 GGTCCCGCACAGATGGGATGCGG + Intergenic
1179387579 21:40957287-40957309 GGTCCCACACAGATGGGACGTGG - Intergenic
1179650344 21:42804400-42804422 GGTCCTGCACAGATGGGACATGG + Intergenic
1179885510 21:44312712-44312734 GGTCCCCCACATGAGGGACATGG - Intronic
1179914142 21:44465311-44465333 TGTCCCTCCCAGATGGGACAGGG + Intergenic
1180560965 22:16613966-16613988 GTGCCTGCACAGATGGGACATGG - Intergenic
1180933052 22:19606278-19606300 GGGCCGACACAGAAGGGCCAGGG + Intergenic
1180946467 22:19696389-19696411 GGTGCCACACAGCTGTGACCAGG + Intergenic
1181311983 22:21949861-21949883 GGTCCCACATAGGTGAGAAATGG + Intronic
1182093019 22:27608943-27608965 GAGCCCACACAGATGAGAGATGG + Intergenic
1182113971 22:27744320-27744342 GGTCCCGCACAGATGGGACGCGG - Intergenic
1182420964 22:30248367-30248389 GGTCCCTCAAAGAAGAGACAAGG - Intergenic
1182732299 22:32505114-32505136 GGTCCCGCACAGATGGGACGCGG - Intergenic
1182998625 22:34836650-34836672 GGTCCTGCACAGATGGGACACGG - Intergenic
1183317046 22:37142550-37142572 GGACCCACACAGCTGGCCCAAGG + Intronic
1183635650 22:39060889-39060911 GGTCCTGCACAGGTGGGGCATGG + Intronic
1184215367 22:43063355-43063377 GGTCCGGCACTGATGGGACTGGG - Intronic
1184302741 22:43572027-43572049 GATCGCACACTGATGGGACAGGG + Intronic
1184745356 22:46452742-46452764 GGTCCTACCTAGAGGGGACAGGG + Intronic
1185104079 22:48857578-48857600 GGCACCACGCAGATGGGGCATGG - Intergenic
1185347077 22:50315148-50315170 GGTCCCTCACAGGTGGGTCCAGG - Intronic
949162074 3:894042-894064 GTTCCTGCACAGATGGGACGCGG + Intergenic
949190378 3:1243185-1243207 GTTCCTGCACAGATGGGACGCGG + Intronic
949671175 3:6400016-6400038 GGTGCCACACAGATGGGATATGG - Intergenic
949827464 3:8179353-8179375 GGTCCCACAGAGATGGGACGCGG - Intergenic
950788422 3:15454098-15454120 GGTCCCACAGCGATGTGCCATGG + Intronic
950926518 3:16746654-16746676 GATCCCGCACAGATGGGATGCGG - Intergenic
951298791 3:20970885-20970907 GGTCCCGCACAGTTGGGACGCGG + Intergenic
951332306 3:21381936-21381958 GGTCCCGCACAGATGGGACATGG + Intergenic
951762773 3:26163743-26163765 GGTCCCGTACAGATGGGACATGG + Intergenic
951888959 3:27551502-27551524 GGTCCTGCACAGATGGGACATGG + Intergenic
952225633 3:31372795-31372817 AGTCCCACAGAGAAGGGTCATGG - Intergenic
952343540 3:32464783-32464805 GGTCCTGCACAGATGGGACACGG + Intronic
952663434 3:35877698-35877720 GGTCCCGCACAGATGGGACATGG + Intergenic
952895196 3:38074037-38074059 GTCCTTACACAGATGGGACATGG + Intronic
952896036 3:38079653-38079675 GGTCCCACACAGATGGGACGTGG + Intronic
953077113 3:39581173-39581195 GGTCCCGCACAGATGGGACGCGG + Intergenic
953177212 3:40563316-40563338 GGTCCTGCACAGATGGGACGCGG - Intronic
953599419 3:44348396-44348418 GGTCCCACACAGATGGGACACGG + Intronic
953656545 3:44859056-44859078 GGTCCCGCACAGTTGGGACACGG + Intronic
954161746 3:48727702-48727724 GTCCCTGCACAGATGGGACACGG + Intronic
954795345 3:53158659-53158681 GGTGCCACACTGGTGGGCCAGGG - Intronic
954969244 3:54637856-54637878 GGTCCCACACAGATGGGACGCGG + Intronic
955069690 3:55561761-55561783 GCTCCCACTCAGATGGGTCATGG - Intronic
955253386 3:57306015-57306037 GGTCCCGCACAGATGGGACGTGG - Intronic
956233480 3:67042054-67042076 GGTCCTGCACAGATGGGACATGG + Intergenic
956709237 3:72025325-72025347 GGTCCCACACAGATGGGACATGG - Intergenic
957059877 3:75473405-75473427 GGTCCCACACAGATGGGACATGG + Intergenic
957155096 3:76536025-76536047 GGTCCTGCACAGGTGGGACATGG + Intronic
957317289 3:78586520-78586542 GGTCCCACACAGTTGGGACGTGG + Intergenic
957734847 3:84191175-84191197 GGTCCCACACAGAAGGGACAAGG + Intergenic
957985709 3:87571693-87571715 GGTCCCGCACAGATGGGACATGG - Intergenic
958421976 3:93940137-93940159 GGTTCTGCACAGATGGGACATGG - Intronic
958676792 3:97276358-97276380 GGTCCCGCACAGATGGGATGCGG + Intronic
958751020 3:98193336-98193358 GGTCCCACACAGATGGGACACGG - Intronic
959288331 3:104443292-104443314 GGTCCCACACAGATGGGACGCGG + Intergenic
959485756 3:106926103-106926125 GATCCCGCACAGATGGGACATGG + Intergenic
959543674 3:107570015-107570037 GGTCCCGTACAGATAGAACATGG + Intronic
959972245 3:112420938-112420960 GGTCCCACACAGATGGGACGCGG + Intergenic
960282854 3:115796879-115796901 GGTCCCACACAGATGGGACGTGG + Intergenic
960310096 3:116108692-116108714 GGTCCCGCAGAGATGGGACGTGG + Intronic
961164740 3:124755926-124755948 GGTCCCACACAGATGGGACGCGG + Intergenic
961293528 3:125866032-125866054 GGTCCCACACAGATGGGACATGG - Intergenic
961711604 3:128832565-128832587 GGTCCCACACAGATGGGACACGG + Intergenic
961730607 3:128962042-128962064 GGTCCCGCACAGATGGGACACGG - Intronic
961881065 3:130061609-130061631 GGTTCCGCACAGATGGGACGTGG - Intergenic
961893694 3:130150513-130150535 GGTCCCACACATATGGGACATGG + Intergenic
962022169 3:131512481-131512503 GGTCCTGCACAGATGGGACAAGG + Intergenic
962205586 3:133431465-133431487 GGTCCCGCACAGATGGGACACGG - Intronic
962523946 3:136221251-136221273 GGACCCACACAGACAGGGCATGG + Intergenic
962660654 3:137597810-137597832 GGTCCCGCATAGATGGGACACGG - Intergenic
962752466 3:138443912-138443934 GGGTCCACACAGATGGGTCTGGG - Intronic
962880958 3:139575934-139575956 GGTCACACACAAATAGGACGTGG - Intronic
963058644 3:141207300-141207322 GGTCCCGCACAGATGGGACATGG - Intergenic
963111819 3:141694660-141694682 GGTCCCACACAGATGGGACATGG + Intergenic
963319766 3:143799619-143799641 GGTCCCACACAGATGGGACATGG - Intronic
963425240 3:145115316-145115338 GGTCCCACACAGATGGGATAAGG - Intergenic
963456645 3:145554549-145554571 GGTCTCGCACAGATGGGACACGG + Intergenic
963468632 3:145712734-145712756 GGTCCCACACAGATGGGATAAGG - Intergenic
963520467 3:146355884-146355906 GGTCCCGTACAGATGGGACATGG - Intergenic
963521643 3:146364389-146364411 GGTCCTGCACAGATGGGACATGG - Intergenic
963663363 3:148153987-148154009 GGTCCCACACAGATGGGACATGG - Intergenic
963684352 3:148416684-148416706 GGTCCCACACAGATGGGACGTGG - Intergenic
964067916 3:152599779-152599801 AGTCCTGCACAGATGGGACATGG - Intergenic
964125433 3:153230067-153230089 GGTCCCACACACATGGGACGTGG + Intergenic
964300233 3:155278556-155278578 GGTCCTACACAGATGGGACATGG + Intergenic
964906499 3:161725235-161725257 GGTCTTGCACAGATGGGACATGG + Intergenic
964940938 3:162157513-162157535 GGTCCTGTACAGATGGGACATGG + Intergenic
964983653 3:162714738-162714760 GGTCCTGCACAGATGGGACATGG - Intergenic
964984849 3:162725897-162725919 GGTCCTGCACAGATGGGATGTGG + Intergenic
965070347 3:163909879-163909901 GGTCCTGCACAGATGGGACGTGG - Intergenic
965105211 3:164345493-164345515 GGTCCTGCACAGATGGGACACGG + Intergenic
965155276 3:165044218-165044240 GGTCCCACACATTTTGGATAGGG + Intronic
965286713 3:166827477-166827499 GGTCCCGCAAAGATGCGACATGG + Intergenic
965336348 3:167433551-167433573 GGTCCTGCACAGATGGGACACGG - Intergenic
965624862 3:170675896-170675918 GGTCCCGCACAGATGGGACATGG + Intronic
965626291 3:170686698-170686720 GGTCCTGCACAGATGGGACATGG + Intronic
965640019 3:170821332-170821354 GGTCCCGCACAGATGGGACATGG + Intronic
965872214 3:173276848-173276870 GGTCCTCCACAGAGGGGGCATGG - Intergenic
966066859 3:175830050-175830072 GGTCGTGCACAGATGGGACACGG - Intergenic
966085450 3:176063671-176063693 GGTCCCGCACAGATGGGACATGG - Intergenic
966105067 3:176324997-176325019 AGTCCTACACAGATGGGACACGG + Intergenic
966232828 3:177669213-177669235 GGTCCTACACAGATGGGACGCGG + Intergenic
966279324 3:178209868-178209890 GGTCCCACAGAGATGGGACAAGG - Intergenic
966397674 3:179519198-179519220 GGTCCCACACAGATGGCACATGG - Intergenic
966398429 3:179524307-179524329 GGTCCCACACAGATGGCACATGG + Intergenic
967005338 3:185377906-185377928 GGTCCCGCACAGATGGGACATGG + Intronic
967152147 3:186660351-186660373 AGTCCTACACAGATGGGATACGG - Intronic
967212146 3:187178903-187178925 GGTCCCACACAGATGGGACGCGG + Intronic
967276808 3:187784263-187784285 TGTCCCAGACAGAGGGAACATGG + Intergenic
967496241 3:190146841-190146863 GGTCCCGCACAGATGGGACGTGG - Intergenic
967624632 3:191669862-191669884 GGTCCCGCACAGATGGGACACGG + Intergenic
967725966 3:192862727-192862749 GGACATACACAGATGGGAGATGG + Intronic
967740507 3:192998019-192998041 GGTCCCACACAGACGGAATACGG - Intergenic
967821374 3:193842356-193842378 GGCTCCACACAGAGGGGACAGGG + Intergenic
968326063 3:197817557-197817579 TGGCCCACACAGATGGGAAAAGG + Intronic
968570495 4:1338016-1338038 AGTTCCACAAAGAGGGGACAAGG - Intronic
968704186 4:2070332-2070354 GGACCCACACACATGGGAGGCGG + Intergenic
968993401 4:3929714-3929736 AGTCCCGCACAGATGGGACGCGG - Intergenic
969003792 4:4003590-4003612 GGTCCTGCACAGATGGGACATGG + Intergenic
969749076 4:9096595-9096617 GGTCCCGCACAGATGGGACATGG - Intergenic
969810136 4:9641235-9641257 GGTCCTGCAAAGATGGGACATGG - Intergenic
970029212 4:11657107-11657129 GGTCCCGCACCGACGGGACGTGG + Intergenic
970532757 4:16999998-17000020 GGTCCCACACAGATGGGACATGG - Intergenic
970744072 4:19274241-19274263 TTTTGCACACAGATGGGACAAGG + Intergenic
970854032 4:20633673-20633695 GGTCCCACACAGATGGAATGTGG + Intergenic
971180581 4:24325546-24325568 GGTCCCGCACAGATGGGACAAGG - Intergenic
971200156 4:24503343-24503365 CGTCCCGCACAGATGGGACACGG - Intergenic
971552673 4:27976300-27976322 GGTCCCCCACAGATGCGACACGG - Intergenic
971747316 4:30600088-30600110 GGTCCCAAGTGGATGGGACAAGG - Intergenic
972070795 4:35018132-35018154 GGTCCCGTACAGATGGGACATGG + Intergenic
973751143 4:54022140-54022162 GGTCCTGTACAAATGGGACACGG - Intronic
974173417 4:58294695-58294717 GGTCCTGCAGAGATGGGACACGG + Intergenic
974428377 4:61767666-61767688 GGTCCCACACAGATGGGACGTGG + Intronic
975152142 4:71033864-71033886 GGGCCCACACAGGCAGGACATGG - Intergenic
975865072 4:78717236-78717258 GGTCCCACACAGATGGGATGCGG + Intergenic
975933869 4:79557355-79557377 GGTCCCACAGAGCTGGGACGTGG + Intergenic
976558590 4:86476923-86476945 GGTCCCGCACAGATGAGACATGG - Intronic
976739936 4:88347125-88347147 GGTCCCACACAGATGGGACATGG + Intergenic
976884552 4:89968170-89968192 GGTCCCACACAGATGGGATGTGG + Intergenic
977010337 4:91626423-91626445 GGTCCCACAAAGATGGGATGCGG - Intergenic
977012905 4:91658000-91658022 GGTCCCACAGAGATGGGAAGCGG + Intergenic
977062491 4:92274868-92274890 GGTCCCACACAGATGGGACACGG + Intergenic
977075185 4:92442339-92442361 GGTCCTACACAGATGGGACACGG + Intronic
977198411 4:94088002-94088024 GGTCCCGCACAGATGGGACACGG + Intergenic
977225325 4:94386846-94386868 GGTCCCGCACAGATGGGACATGG + Intergenic
978001100 4:103557141-103557163 GGTCCCACACAGATGGGACGTGG + Intergenic
978031503 4:103943474-103943496 GGTCCCGTACAGATGGGACATGG - Intergenic
978303211 4:107293798-107293820 GGTCCCACACAGATGGGACATGG + Intergenic
978438629 4:108711360-108711382 GGTCCCACACAGATGGGACATGG - Intergenic
979054602 4:115979031-115979053 GGTCCCACACAGATAGGACGCGG + Intergenic
979146637 4:117254433-117254455 GGCTCCACACAGATGGGACATGG - Intergenic
979171389 4:117603687-117603709 AGTCCTGCACAGATGGGATATGG + Intergenic
979850290 4:125565014-125565036 GGTCCCACACAGATGGGACGCGG + Intergenic
980111905 4:128644215-128644237 GGTCGCATACAGATGGGACACGG + Intergenic
980284967 4:130769693-130769715 GGTCCTGCACAGATGGGACACGG - Intergenic
980472420 4:133267070-133267092 GGTCCCATACAGATGGGACGCGG + Intergenic
980575617 4:134681284-134681306 GGTCCCGCACAGATGGGACGTGG + Intergenic
980611759 4:135170668-135170690 GGTCCTGCACAGATGGGACACGG + Intergenic
980903956 4:138930204-138930226 GGTCCTGCACAGATGGGAAGCGG - Intergenic
981040263 4:140215827-140215849 GGTCCCACACAGATGGGACATGG - Intergenic
981482709 4:145254923-145254945 GGTCCCACACAGATGGGACATGG + Intergenic
981525229 4:145701433-145701455 GTCCCCGCACAGATGGGACACGG - Intronic
982083948 4:151815980-151816002 GGTCCCGCACAGTTGGGACACGG + Intergenic
982180462 4:152744710-152744732 GTCCCTGCACAGATGGGACATGG + Intronic
982318827 4:154058613-154058635 GGTCCCACAAAGATGGGACATGG - Intergenic
982461404 4:155673772-155673794 GGCCCCACAAAGATTGAACAAGG - Intronic
982497089 4:156106844-156106866 GGTCCCGCACAGATGGGACACGG + Intergenic
982535466 4:156602615-156602637 GGTCCCACACAGATGGGACATGG - Intergenic
983023891 4:162711434-162711456 GGTCCCACACAGATGGGACATGG - Intergenic
983055507 4:163095421-163095443 GGTCCCGCACAGATGGGACACGG - Intergenic
983345577 4:166522855-166522877 GGTCCCACACAGATGGGACATGG - Intergenic
983360425 4:166718633-166718655 GGTCCCACACAGATGGGACGCGG - Intergenic
983448075 4:167878584-167878606 GGTCCCGCACAGATGGGACACGG - Intergenic
983452353 4:167925227-167925249 GGTCCCACACAGATGGGACGTGG - Intergenic
983659590 4:170118787-170118809 GGTCCTGCACAGATGGGACACGG - Intergenic
983707692 4:170679825-170679847 GGTCCTGCACAGATGGGACACGG - Intergenic
983805770 4:171989408-171989430 GTTCCTACACAGATGGGATACGG + Intronic
983883739 4:172959747-172959769 GGTCCTGCACAGATGGGACATGG + Intronic
984099030 4:175464812-175464834 GGTCCCGCACAGATGGGATGTGG + Intergenic
984165339 4:176298226-176298248 GGTCCTGCACAGATGGGACATGG + Intergenic
984322208 4:178209455-178209477 GGTCCCATACAGATGGGACATGG - Intergenic
984393596 4:179168267-179168289 GGTCCCGCACAGATGGGACACGG + Intergenic
984437282 4:179722779-179722801 GGTCCCACACAGATGGGACGTGG - Intergenic
984700690 4:182816855-182816877 GGTCCCGCACAGATGGGACACGG - Intergenic
985057379 4:186047575-186047597 GGTCCTGCACAGATGGGACGTGG + Intergenic
985296791 4:188444725-188444747 GGGCACAGAGAGATGGGACAAGG + Intergenic
985389850 4:189482841-189482863 GGTCCCGCACAGATGGGACGCGG + Intergenic
985435739 4:189928186-189928208 GGTCCTGCACAGATGGGACATGG - Intergenic
986022049 5:3813308-3813330 GGTCACACACAGAATGGTCAGGG + Intergenic
986193553 5:5517888-5517910 GGTCCCGCACAGATGGGACATGG - Intergenic
986368962 5:7061688-7061710 GGTCCCGCACGGATGGGACACGG + Intergenic
986388898 5:7265918-7265940 GGTCCCACACAGATGGGACGCGG - Intergenic
986502657 5:8416429-8416451 GGTCCTGCACAGATGGGACATGG - Intergenic
986555023 5:9001923-9001945 GGTCCTGCACAGATGGGACACGG + Intergenic
986905791 5:12492134-12492156 GGTCCCGCACAGATGGGACACGG - Intergenic
986919570 5:12665917-12665939 GGTCTCACACAGATGGGACGCGG + Intergenic
987486858 5:18536008-18536030 GGTCCCACACAGATGGGATGCGG - Intergenic
987498102 5:18672236-18672258 GGTCCCACACAGATGGGACGCGG + Intergenic
988199116 5:28047972-28047994 GGTCCCGCACAGATGGGACATGG - Intergenic
989615140 5:43331316-43331338 GGTCCCACAAAGATGGGACTTGG + Intergenic
989659945 5:43788447-43788469 GATCCCACACAGATGGGACATGG - Intergenic
989688884 5:44118112-44118134 GGTCCTGCACAGCTGGGACATGG + Intergenic
990565107 5:57020358-57020380 GGTCCTGCAGAGATGGGACATGG + Intergenic
992394683 5:76359687-76359709 GGTCCCGCACAGATGGGTCACGG - Intergenic
992451984 5:76883761-76883783 GGTCCCGCACAGATGGGACATGG + Intronic
992524157 5:77590428-77590450 GGGACCACACAGATGGCACATGG + Intronic
992960849 5:81955591-81955613 GGTCCCGCACAGATGGGACGTGG - Intergenic
993192732 5:84700812-84700834 GGTCCCACACAGATGGGACGTGG - Intergenic
994295165 5:98081398-98081420 GGTCCTGCACAGATGGGACACGG - Intergenic
994324895 5:98436899-98436921 GGTCCTGCACAGATGGAACTTGG - Intergenic
994532528 5:100987632-100987654 GGTCCCACACAGATGGGACGTGG + Intergenic
994775702 5:104033950-104033972 GGTCCCACACAGATGGGACATGG - Intergenic
994989572 5:106980713-106980735 GGTCCCGCACAGATGGGACACGG - Intergenic
995125143 5:108571834-108571856 GGTCTCGCACAGATGGGACACGG + Intergenic
995769400 5:115652864-115652886 GGTCCTGCACAGTTGGCACATGG - Intergenic
995899349 5:117049742-117049764 GGTCCCGCACAGATGGGACATGG + Intergenic
996344802 5:122476982-122477004 GGTCCCACACAGATGGGATACGG + Intergenic
996358605 5:122622245-122622267 GGTCCTGCACAGATGGGACATGG + Intergenic
996509920 5:124306125-124306147 GGTCCTGCACAGATGGGACACGG - Intergenic
996517198 5:124383612-124383634 AGTCCCACACAGAGAAGACAAGG + Intergenic
996528072 5:124499387-124499409 GGTCCTGCACAGATGGGACACGG - Intergenic
996574978 5:124969977-124969999 GGTCCTGCAGAGATGGGACACGG + Intergenic
996745427 5:126842936-126842958 GGTCCCACACAGACGGGACGCGG + Intergenic
996912424 5:128670598-128670620 GGTCCCGCACAGATGGGACATGG + Intronic
996917701 5:128731879-128731901 GATCCCACACAGATGGGACATGG - Intronic
996984788 5:129546433-129546455 AGTCCCACGAAGATGGGTCAAGG - Intronic
997678843 5:135735052-135735074 GGTCCCGCACAGATGGGACACGG + Intergenic
997746421 5:136303646-136303668 GGTCCCACACAGATGGGACACGG - Intronic
997769661 5:136542990-136543012 GGTCCCACAGAGATGGGACGTGG + Intergenic
997770609 5:136549698-136549720 GTCCCTGCACAGATGGGACATGG + Intergenic
997772624 5:136568725-136568747 GGTCCTACACAGATGGGACGTGG + Intergenic
998693683 5:144614715-144614737 GATCCCGCACAGATGGGACACGG + Intergenic
998996380 5:147872350-147872372 GGTCCTACACAGATGGGACACGG + Intronic
999618848 5:153453087-153453109 GGTCCCCCAGAGATGGGATACGG + Intergenic
1000438602 5:161242300-161242322 GGTCCCGCACAGATGGGATGTGG - Intergenic
1000439739 5:161250825-161250847 GGTCCCGCACAGATGGGACGTGG - Intergenic
1000606951 5:163336357-163336379 GGTCCTGCACAGATGGGACATGG - Intergenic
1000885300 5:166742469-166742491 GGTCCCACACAGATGGGACACGG + Intergenic
1000935622 5:167301265-167301287 GGTCCCACACAGATGGGACATGG + Intronic
1001331433 5:170765411-170765433 GGTCCCGCACAGATGGGACACGG + Intronic
1001354291 5:171004766-171004788 GGGCCCACACAGACAGGGCACGG + Intronic
1002610941 5:180418103-180418125 GGTCCCACACAGATGGGATGCGG + Intergenic
1002728808 5:181319972-181319994 AGACCCACACAGATGGGATTTGG + Intergenic
1004106286 6:12669710-12669732 GGTCCCGCACAGATGGGACATGG - Intergenic
1004283501 6:14300329-14300351 GTTCCCACACAGATGGGACGCGG + Intergenic
1004575241 6:16888289-16888311 GGTCCCGCACAGATGGGACTTGG - Intergenic
1004768555 6:18757443-18757465 GGTCCCGCACAGATGGGACGCGG + Intergenic
1004837022 6:19541237-19541259 GGTCCTGCACAGATGGGACACGG - Intergenic
1005014638 6:21364885-21364907 GGTCCCACACAGATGGGACGTGG + Intergenic
1005786554 6:29250584-29250606 GGACCTGCACAGATAGGACACGG + Intergenic
1006324872 6:33346165-33346187 GGTCCTGCACAGATGGGACACGG - Intergenic
1007300965 6:40867584-40867606 GTCCCTGCACAGATGGGACATGG + Intergenic
1007343704 6:41210214-41210236 GGCGCCACACAGAGGGGACCTGG - Intergenic
1008476547 6:51940516-51940538 GGTCCCACACAGATGGGGCATGG - Intronic
1008850191 6:56014193-56014215 GGTCCCACACACATGGGACGCGG + Intergenic
1009359372 6:62793837-62793859 GGTCCCACATTGATGGGACATGG - Intergenic
1009379162 6:63007646-63007668 GGTCCCACAGAGATGGGACATGG - Intergenic
1009464354 6:63952239-63952261 GATCCCACACAGATAGGACATGG - Intronic
1009750286 6:67872343-67872365 GGTCCCACATAGATGGGACATGG + Intergenic
1010071705 6:71751925-71751947 GGTCCCGCACAGATGGGACACGG + Intergenic
1010586677 6:77663933-77663955 GGTCCCACACAGATGGGACGCGG + Intergenic
1010662332 6:78585727-78585749 GGTCCCGCACAGATGGGACACGG - Intergenic
1010826894 6:80485815-80485837 GGTCCCGCACAGATGGGACACGG + Intergenic
1010841294 6:80651175-80651197 GGTCCCGCACAGATGGGACATGG + Intergenic
1010894527 6:81348515-81348537 GGTCCCGCACAGATGGGACACGG + Intergenic
1011367880 6:86601748-86601770 GGTCCCGCACAGATGGGACATGG + Intergenic
1011770922 6:90673590-90673612 GGTCCCACACAGATGGGACGTGG + Intergenic
1012014372 6:93833456-93833478 GATCCCACACAGATGGGACGCGG + Intergenic
1012066524 6:94557322-94557344 GGTCCCACACAGATGGGACGCGG + Intergenic
1012315844 6:97781931-97781953 GGTCCCACACAGATGGGACGCGG - Intergenic
1012689593 6:102295258-102295280 GGTCCTACACAGATGGGATGTGG - Intergenic
1013808066 6:114015690-114015712 GGTCCCACACAGATGGGATGTGG + Intergenic
1013891725 6:115034213-115034235 GGTCCCACACAGATGGGATGCGG - Intergenic
1014115321 6:117663063-117663085 GGTCCTGCACAGATGGGACATGG + Intergenic
1014126408 6:117781310-117781332 GGACCCACGTAGATGGGTCAGGG + Intergenic
1014360140 6:120465644-120465666 GGTCCCACACAGATGGGACGTGG + Intergenic
1014396083 6:120927522-120927544 GGTCCTGCACAGATGGGACGTGG - Intergenic
1014454851 6:121623817-121623839 GGTCCCACAGAGATGGGACGTGG + Intergenic
1014555868 6:122842161-122842183 GGTCCCACACAGATGGGACGCGG - Intergenic
1014614655 6:123585666-123585688 GGTTCCGTACAGATGGGACGTGG + Intronic
1014718916 6:124894369-124894391 GGTCCCACACAGATGGGATGTGG - Intergenic
1014793970 6:125705239-125705261 GGTCCCACACAGATGGGATGCGG + Intergenic
1014891562 6:126851086-126851108 GGTCCCGCACAGATGGGACATGG - Intergenic
1015165236 6:130194676-130194698 GGTCCTGCACAGATGGGACGCGG - Intronic
1015266757 6:131297788-131297810 GGTCCCACACAGAGGGGACGCGG - Intergenic
1015269674 6:131325735-131325757 GGTCCTGCACAAATGGGACACGG - Intergenic
1015271393 6:131341213-131341235 GGTCCCACACAGATGGGACACGG - Intergenic
1015323850 6:131904018-131904040 GGTCCCACACAGATGGGACGCGG - Intergenic
1016114122 6:140260788-140260810 GGTCCCACACAGATGGGACGTGG + Intergenic
1016151306 6:140745867-140745889 GGTCCCACACTCATGGCAGAAGG - Intergenic
1016204555 6:141455162-141455184 GGTCCTGCACAGATGGGACACGG - Intergenic
1016248882 6:142018140-142018162 GGTCCCACACAGATGGGATGCGG - Intergenic
1016518826 6:144925504-144925526 GGTCCCACACAGATGGGACGTGG - Intergenic
1016535741 6:145106527-145106549 GGTCCCACACAGATGGGACGCGG + Intergenic
1016650273 6:146453793-146453815 GGTCCCGCACAGATGGGACATGG + Intergenic
1017389522 6:153923817-153923839 GGTCCCACACAGATGGGACGCGG - Intergenic
1017779315 6:157704025-157704047 GGTCCTGCACAGATGGGACACGG + Intronic
1017960252 6:159215519-159215541 GGTCCCATTAAGATGAGACATGG + Intronic
1017980717 6:159399081-159399103 GGAACCACACAGCAGGGACAGGG + Intergenic
1018077615 6:160230826-160230848 GGTCCTGCACAGATGGGACATGG - Intronic
1018084476 6:160289949-160289971 GGTCCCACACAGATGGGAAGCGG + Intergenic
1018495384 6:164342111-164342133 TGTCCCGCACAGATGGGACTCGG + Intergenic
1018521451 6:164655529-164655551 GTTCCTGCACAGATGGGACGCGG + Intergenic
1020243591 7:6413788-6413810 CGTCCCGCACAGCTGGGAGAAGG + Intronic
1020316069 7:6906122-6906144 GGTCCCGCACAGATGGGACGTGG - Intergenic
1020323927 7:6960045-6960067 GGTCCTGCACAGATGGGACATGG + Intergenic
1020532694 7:9356797-9356819 GGTCCCGCACAGATGGAACGCGG + Intergenic
1021393644 7:20122935-20122957 GGTCCCACACAGATGGGACGTGG - Intergenic
1021637335 7:22705576-22705598 GGTCCCGCACAGATGGGACACGG - Intergenic
1021660643 7:22915451-22915473 GGTCCTGCACAGATGGGACATGG - Intergenic
1021810680 7:24398609-24398631 GGTCCCGCACAGATGGGACATGG - Intergenic
1021977877 7:26027565-26027587 GGTCCCGCACAGATGGGACATGG + Intergenic
1022372891 7:29787179-29787201 GGTCCCGCACAGATGGGACACGG - Intergenic
1022447421 7:30481564-30481586 GGTCCTGCACAGATGGGACATGG - Intergenic
1022572773 7:31470405-31470427 GGTCCCGCACAGATGGGACATGG + Intergenic
1022710028 7:32841281-32841303 GGTCCCACACAGATGGGACACGG + Intergenic
1022854692 7:34303270-34303292 GGTCCTGCACAGATGGGACACGG + Intergenic
1023399488 7:39781593-39781615 AGACCCACACAGATGGGATTTGG + Intergenic
1023698867 7:42873985-42874007 GGTCCCGCACAGATGGGACATGG + Intergenic
1024739233 7:52337023-52337045 GGTCCCACACAGATGGGACATGG + Intergenic
1025055086 7:55758688-55758710 AGACCCACACAGATGGGATTTGG - Intergenic
1025133158 7:56388914-56388936 AGACCCACACAGATGGGATTTGG - Intergenic
1025185948 7:56858527-56858549 GGACCCACACAGATGGGATTTGG - Intergenic
1025685978 7:63718414-63718436 GGACCCACACAGATGGGATTTGG + Intergenic
1025910877 7:65827448-65827470 AGACCCACACAGATGGGATTTGG + Intergenic
1025977459 7:66380076-66380098 AGACCCACACAGATGGGATTTGG - Intronic
1025978873 7:66391681-66391703 GGACCCACACAGATGGGATTTGG - Intronic
1027157906 7:75781485-75781507 GGTCCCACACAGATGGGACAAGG - Intronic
1027203141 7:76075213-76075235 AGACCCACACAGATGGGATTTGG - Intergenic
1027354442 7:77342030-77342052 GGTCCCGCATAGATGGGACACGG - Intronic
1027471438 7:78579023-78579045 TGAGCCACACAGATGAGACATGG - Intronic
1028589892 7:92483166-92483188 GGTCCTGCACAAATGGGACGTGG + Intergenic
1028670529 7:93396263-93396285 GGTCCCACACAGATGGGTCACGG - Intergenic
1028690196 7:93642193-93642215 GGTCCCACACAGATGGGACATGG - Intronic
1029189374 7:98760919-98760941 GATCCCATACAGATTAGACATGG + Intergenic
1029256481 7:99273089-99273111 GGTCCCTCCCAGATGGCACAAGG - Intergenic
1029724163 7:102391091-102391113 TGACTCACACAGATGGGACAGGG - Intronic
1029926431 7:104324035-104324057 GGCCCCACACTGAAGGTACAAGG + Intergenic
1030193498 7:106831974-106831996 GGTCCTGCACAGACAGGACAAGG - Intergenic
1030445763 7:109645496-109645518 GGTCCTGCACAGATGGGACACGG + Intergenic
1031004687 7:116457816-116457838 GGTCTCACACAGATGGGACGCGG - Intronic
1031355173 7:120780522-120780544 GGTCCTACACAGATGGGAGGCGG + Intergenic
1031364727 7:120888990-120889012 GGTCCTGCACAGATGGGACACGG + Intergenic
1031400003 7:121317908-121317930 GGTCCCGCAAAGATGGGACACGG - Intergenic
1031525610 7:122819253-122819275 GGTCCCACACAGATGGGACGTGG - Intronic
1031685865 7:124731371-124731393 GGTCCCGCACAGATGGGACGCGG - Intergenic
1031727911 7:125262280-125262302 GGTCCCACACAGAAGGGACATGG + Intergenic
1031776343 7:125912321-125912343 GGTCCCACACAGATGGGACACGG - Intergenic
1031777365 7:125919946-125919968 GGTCCCACACAGATGGGACTTGG - Intergenic
1033084736 7:138331361-138331383 GGTCCCACACAGATGGGACATGG - Intergenic
1033088577 7:138364882-138364904 GGTCCCGCACAGATGGGACATGG - Intergenic
1033211538 7:139463624-139463646 GGTCCCATACACATGGGACACGG - Intronic
1033675929 7:143540600-143540622 GGTCCCACACAGACGGGACGTGG + Intergenic
1033695905 7:143788839-143788861 GGTCCCACACAGATGGGACGCGG - Intergenic
1033909450 7:146246757-146246779 TGTCCTGCACAGATGGGACTCGG + Intronic
1034084813 7:148313428-148313450 GGTCCCGCACAGATGGGACATGG + Intronic
1034334143 7:150309686-150309708 GGTCCCGCACAGGTGGGACACGG - Intronic
1035245102 7:157558135-157558157 GTTCACACACAGATAGGACTCGG - Intronic
1035684398 8:1512902-1512924 GTGCACACACAGATGGCACAGGG - Intronic
1035880646 8:3241594-3241616 GGTCCTGCACAGACGGGACACGG + Intronic
1036070906 8:5440019-5440041 GGTCCTGCACAGATGGGATGTGG + Intergenic
1036147839 8:6270857-6270879 GGCTCCACACAGGTGGGGCACGG + Intergenic
1036281501 8:7404768-7404790 GGTCCCACACAGATGGGACGCGG - Intergenic
1036339968 8:7906804-7906826 GGTCCCACACAGATGAGACGCGG + Intergenic
1036372148 8:8170939-8170961 GGTCTCGCACAGATGGGACATGG - Intergenic
1036472311 8:9062813-9062835 GGTCTCGCTCAGATGGGACGTGG + Intronic
1036639511 8:10573601-10573623 GGTCCTGCATAGATGGGACACGG - Intergenic
1036878753 8:12494702-12494724 GGTCTCGCACAGATGGGACATGG + Intergenic
1039498983 8:38002055-38002077 GGCCCCGCACAGATGGGACATGG + Intergenic
1041386897 8:57313827-57313849 GGTGCCACCCAGATGGGAGAGGG + Intergenic
1041651824 8:60309878-60309900 GGTCCCGCATAGATGGGACATGG + Intergenic
1041917515 8:63151675-63151697 GGGTCTGCACAGATGGGACACGG + Intergenic
1043353651 8:79389483-79389505 GGTCCCACACAGATGGGACGTGG + Intergenic
1043597436 8:81901915-81901937 GGTCCCACACAGATGGGACATGG + Intergenic
1043598866 8:81915779-81915801 GATCCCACACAGATGGGACATGG - Intergenic
1043717879 8:83508519-83508541 GGTCCCGCACAGATGGGACACGG + Intergenic
1043837756 8:85065305-85065327 GGTCCTGCACAGATGGGACACGG - Intergenic
1044258597 8:90093582-90093604 GGTCCCGCACAGATGGGACATGG + Intronic
1044417102 8:91950300-91950322 GGTCCCGCACAGATGGGACACGG - Intergenic
1044922012 8:97177407-97177429 GGTCCCACACAGATGGGACATGG - Intergenic
1044925179 8:97203251-97203273 GGTCCCACACAGATGGGACGCGG - Intergenic
1045197543 8:99946202-99946224 GGTCCCACACAGATGGGACGCGG - Intergenic
1045644801 8:104288266-104288288 GGTCCCACACAGATGGGACGCGG - Intergenic
1046294137 8:112198155-112198177 GGTTCCACAAAGATGGGACATGG - Intergenic
1046386321 8:113512891-113512913 GGTCCCACACAGATGGGACGCGG + Intergenic
1046440032 8:114243669-114243691 GGTCCCACACAGATGGGACGCGG - Intergenic
1046443263 8:114284321-114284343 GGTCCCACACAGATGGGATGCGG - Intergenic
1046512106 8:115214558-115214580 GGTCCCACACAGATGGGACGTGG - Intergenic
1046559297 8:115816940-115816962 GGTCCCGCACAGATGGGATACGG - Intergenic
1047396842 8:124508122-124508144 GGTCCCACACACTTGGGATAAGG - Intronic
1047699367 8:127434060-127434082 GGTCCCACACAGATGGGACACGG - Intergenic
1047829526 8:128615286-128615308 GGTCCCGCACAGATGGGACACGG + Intergenic
1048097628 8:131312537-131312559 GGTCCTACACAGATGGGATACGG - Intergenic
1048168415 8:132083615-132083637 GGTCCCACACAGATGGGACGCGG + Intronic
1048502326 8:134989447-134989469 GTTCCCACACAGAAAGAACAGGG - Intergenic
1049321599 8:141999714-141999736 GACCCCACACCGATGGCACATGG - Intergenic
1049603068 8:143516957-143516979 GATCCCACACGGGGGGGACAGGG - Intronic
1049720293 8:144112455-144112477 GCTGCCAAAGAGATGGGACAAGG + Exonic
1049868799 8:144957637-144957659 GGTCCCGCACAGATGGGACATGG + Intergenic
1050117623 9:2277899-2277921 GGTCCCACACAGATGGGATGCGG - Intergenic
1050258086 9:3814529-3814551 GGTCCCACAAAGATGGGACATGG + Intergenic
1050896092 9:10887099-10887121 GGTCCTGCAGAGATGGGACATGG - Intergenic
1051052644 9:12950654-12950676 GGTCCCACACAGATGGGACATGG - Intergenic
1051849267 9:21489079-21489101 GGTCCCGCACAGATGGGACACGG + Intergenic
1052040927 9:23738220-23738242 GGTACCACACAGCAGGGAAAAGG + Intronic
1052163102 9:25290005-25290027 GGTCCCACACAGATGGGACGTGG - Intergenic
1052191852 9:25671259-25671281 GTTCCTGCACAGATGGGACGCGG - Intergenic
1052653354 9:31328747-31328769 GGTCCTGCACAGATGGGATGCGG - Intergenic
1052720622 9:32167889-32167911 GGTCCTGCACAGATGGGACATGG + Intergenic
1053002705 9:34586059-34586081 GAGCCCACACAGTAGGGACATGG - Intronic
1053058050 9:35005821-35005843 GGTCCTGCACAGATGGGACGCGG - Intergenic
1053059902 9:35022684-35022706 GGTCCCACACAGATGGGACACGG + Intergenic
1053078443 9:35154610-35154632 GGTCTCATACAGATGGGACACGG + Intergenic
1053134690 9:35643181-35643203 GGGCCCACACAGACAGGGCACGG - Intronic
1053758410 9:41332777-41332799 GGCCTCACACAGCTGGGCCATGG - Intergenic
1054763871 9:69026640-69026662 TATCCCCCACAGATGGGAGACGG + Intergenic
1054807469 9:69408130-69408152 GGTCCTGCACAGATGGGACACGG + Intergenic
1055233082 9:74087996-74088018 GGTCCCACACAGATGGGACGCGG - Intergenic
1055347697 9:75355158-75355180 GGTCCCGCACAGATGGGACACGG + Intergenic
1055626741 9:78183140-78183162 GGTCCCGCACAGATGGGACACGG - Intergenic
1055810067 9:80139744-80139766 GGTCCCACACAGATGGGACGTGG - Intergenic
1056044720 9:82704089-82704111 GGTCCCGCACAAATGGGACATGG + Intergenic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1056323907 9:85460979-85461001 GGTCCCACACAGATGGGACACGG - Intergenic
1056363729 9:85883018-85883040 TGTCCCGCACAGATGGGACATGG - Intergenic
1056522466 9:87413259-87413281 GGTCCCACACAGATGGGACGCGG - Intergenic
1056882999 9:90414908-90414930 GGTCCCACACAGATGGGACGTGG - Intergenic
1057209001 9:93189481-93189503 GGTGCCACCCAGAGGGGGCAGGG + Intronic
1057234867 9:93349938-93349960 GGTCCCACACAGATGGGACGTGG - Intergenic
1057378009 9:94542160-94542182 GGTCCTGCACAGATGGGACACGG - Intergenic
1057684020 9:97217176-97217198 GGTCCCACACAGATGGGACATGG - Intergenic
1057812561 9:98269188-98269210 GGTCCTGCACAGATGGGACACGG + Intergenic
1057982101 9:99672492-99672514 GGTCCCACATAGATGGGACATGG - Intergenic
1058026188 9:100144071-100144093 GGTCCTACACAGATGGGACACGG + Intronic
1058612419 9:106790530-106790552 GGTCCTGCACAGATGGGACACGG - Intergenic
1059546140 9:115177997-115178019 GGTCCTGCACAGATGGGACATGG + Intronic
1059574638 9:115475692-115475714 GGTCCTGCACAGATGGGACACGG - Intergenic
1059606687 9:115842582-115842604 GGTCCCACACAGATGGGACGCGG + Intergenic
1059754794 9:117282446-117282468 TGGCCCACACTAATGGGACAGGG + Intronic
1059863467 9:118489051-118489073 GGTCCCACACAGATGGGACGCGG + Intergenic
1060226216 9:121792657-121792679 GTCCCTGCACAGATGGGACATGG - Intergenic
1060526325 9:124323295-124323317 GGTCCCACAGGGATGGGAAAGGG + Intronic
1060737860 9:126078005-126078027 GGTCCCCCACAGATGGGACACGG + Intergenic
1061583090 9:131549419-131549441 GGTCCCGCACAGATGGGACATGG - Intergenic
1062123780 9:134848617-134848639 GGACCCACACAGAGGGCACGTGG - Intergenic
1062226391 9:135454744-135454766 GGTCCCAAACCTATGGCACATGG + Intergenic
1203576385 Un_KI270745v1:11850-11872 AGACCCACACAGATGGGATTTGG + Intergenic
1185858410 X:3556501-3556523 GGTCCCGCACAGATGGGACACGG + Intergenic
1185960672 X:4543861-4543883 GGTCCCGCACAGATGGGACACGG + Intergenic
1185991079 X:4893925-4893947 GGTCCCGCACAGATGGGACACGG - Intergenic
1186581736 X:10826962-10826984 AGTCCCATGAAGATGGGACAAGG - Intronic
1186784088 X:12942156-12942178 GGTCCCGCACAGATGGGACACGG - Intergenic
1187099939 X:16182534-16182556 GGTCCTGCACAGATGGGACACGG + Intergenic
1188301039 X:28505802-28505824 GTCCCTGCACAGATGGGACATGG + Intergenic
1188332998 X:28895967-28895989 GGTCCCACACAGATGGCACGCGG + Intronic
1188431044 X:30105677-30105699 GGTCCCACACAGATGGGACGCGG - Intergenic
1188463357 X:30452471-30452493 GGTCCTGCACAGATGGGACACGG + Intergenic
1188552673 X:31379838-31379860 GGTCCTCCACAGATGGGACATGG - Intronic
1189031793 X:37459145-37459167 GGTCCCGCACAGATGGGACATGG + Intronic
1190736056 X:53256566-53256588 GGCCTCACACAGCTGGGACAGGG - Intronic
1191014175 X:55791683-55791705 GGTCCTGCACAGATGGGACATGG + Intergenic
1191805794 X:65133011-65133033 GGTCCTGTACAGATGGGACATGG + Intergenic
1191825572 X:65362051-65362073 GTTCCCACACTGATGGGACATGG - Intergenic
1192454612 X:71266516-71266538 GGTCCTGCACAGATGGGACATGG - Intergenic
1192706159 X:73529999-73530021 GGTCCTGCACAGATGGGATGTGG - Intergenic
1192731503 X:73806288-73806310 GGTCCTGCATAGATGGGACATGG + Intergenic
1192914114 X:75635642-75635664 GGTCCCACACAAATGGGACATGG + Intergenic
1193537114 X:82729194-82729216 AGTCCCACACAGAAGGGACATGG - Intergenic
1193714888 X:84926692-84926714 GATCCCACACACATCAGACAGGG - Intergenic
1193811274 X:86054497-86054519 GGTCCCACACCCATGGAACCTGG - Intergenic
1193885947 X:86984139-86984161 GGTCCCGCACAGATGGGACAAGG - Intergenic
1193941519 X:87684223-87684245 GGTCCCACACAGATGGGACGCGG - Intergenic
1194186230 X:90776694-90776716 GGTCCCGCACAGATGGGACACGG + Intergenic
1194293604 X:92103612-92103634 GGTCCCACACAGATGGGACGTGG + Intronic
1194367124 X:93025267-93025289 GGTCCTGCACAGATGGGACGTGG - Intergenic
1194502964 X:94702195-94702217 GGTCTCGCACAGATGGGACGCGG + Intergenic
1194660708 X:96626360-96626382 GGTCCCGCACAGATGGGACGTGG - Intergenic
1194873779 X:99162813-99162835 GGTCCCACACAGATGGGACGTGG + Intergenic
1195016931 X:100789796-100789818 GGTCCCGCACAGATGGGACATGG + Intergenic
1195291135 X:103432905-103432927 GGTCCCATACAGATGGGACACGG + Intergenic
1195841505 X:109180755-109180777 GGTCCCACACAGATGGGACATGG - Intergenic
1195893273 X:109719270-109719292 GGTACCACAGAGATAAGACAGGG + Intronic
1195908659 X:109868591-109868613 GGTCCCGCACAGATGGGACACGG + Intergenic
1196073100 X:111546251-111546273 GGTCCCACATAGATGGGACGCGG - Intergenic
1196220963 X:113112094-113112116 GGTCCCGCACAGATGGGACATGG + Intergenic
1196300031 X:114042317-114042339 GGTCCTGCACAGATGGGACGCGG - Intergenic
1196330845 X:114469097-114469119 GGTCCCACACAGATGGGACGCGG - Intergenic
1196341698 X:114604678-114604700 GGTCCCACACAGATGGGACACGG + Intronic
1196469923 X:116013007-116013029 GTCCCTGCACAGATGGGACATGG - Intergenic
1196572517 X:117281493-117281515 GGTCCCGCACAGATGGGACATGG - Intergenic
1196773836 X:119321141-119321163 GGTCCCGCACAGATGGGACATGG + Intergenic
1197064935 X:122224369-122224391 GGTCCCGCACACATGGGATGTGG - Intergenic
1197352037 X:125392221-125392243 GGTCCCACACAGATGGGATGCGG + Intergenic
1197470982 X:126865437-126865459 GGTCCTGCACAGATGGGACATGG - Intergenic
1197499741 X:127228934-127228956 GGTCCCACACAGATGGGACACGG - Intergenic
1197793655 X:130279369-130279391 GGTCCCACACAGATGGGACATGG - Intergenic
1197933105 X:131714406-131714428 GGTCCCACACAGATGGGATGCGG - Intergenic
1198598465 X:138261154-138261176 GGTCCTACACGTATGGGATACGG - Intergenic
1198599381 X:138267685-138267707 GGTCCCGCACAGATGCTACACGG + Intergenic
1198965942 X:142228884-142228906 GTTCCTGCACAGATGGGACATGG - Intergenic
1198983736 X:142426941-142426963 GGTCCCACACAGATGGGACACGG + Intergenic
1199576498 X:149318000-149318022 GGTCCCACACAGATGGGACATGG - Intergenic
1200532820 Y:4358773-4358795 GGTCCCGCACAGATGGGACATGG + Intergenic
1200611123 Y:5328158-5328180 GGTCCCACACAGATGGGACGTGG + Intronic
1200675337 Y:6141523-6141545 GGTCCTGCACAGATGGGATGTGG - Intergenic
1201307487 Y:12563304-12563326 GGTCCTGCACAGATGGGACGTGG + Intergenic
1201581407 Y:15514709-15514731 AGTCCTGCACAGATGGGACATGG - Intergenic