ID: 1047703416

View in Genome Browser
Species Human (GRCh38)
Location 8:127473197-127473219
Sequence AACCCACTCCTTATTCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047703413_1047703416 9 Left 1047703413 8:127473165-127473187 CCCACTACAAAAGCATGGAACTG No data
Right 1047703416 8:127473197-127473219 AACCCACTCCTTATTCCCAGAGG No data
1047703414_1047703416 8 Left 1047703414 8:127473166-127473188 CCACTACAAAAGCATGGAACTGA No data
Right 1047703416 8:127473197-127473219 AACCCACTCCTTATTCCCAGAGG No data
1047703411_1047703416 28 Left 1047703411 8:127473146-127473168 CCTCAGATATCATAGTTTTCCCA No data
Right 1047703416 8:127473197-127473219 AACCCACTCCTTATTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047703416 Original CRISPR AACCCACTCCTTATTCCCAG AGG Intergenic
No off target data available for this crispr