ID: 1047703456

View in Genome Browser
Species Human (GRCh38)
Location 8:127473381-127473403
Sequence TACTTGTCGGAGGGTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047703456_1047703466 13 Left 1047703456 8:127473381-127473403 CCCTCCCCACCCTCCGACAAGTA No data
Right 1047703466 8:127473417-127473439 CCTTGACCTCTGACTCACTGTGG No data
1047703456_1047703467 14 Left 1047703456 8:127473381-127473403 CCCTCCCCACCCTCCGACAAGTA No data
Right 1047703467 8:127473418-127473440 CTTGACCTCTGACTCACTGTGGG No data
1047703456_1047703468 15 Left 1047703456 8:127473381-127473403 CCCTCCCCACCCTCCGACAAGTA No data
Right 1047703468 8:127473419-127473441 TTGACCTCTGACTCACTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047703456 Original CRISPR TACTTGTCGGAGGGTGGGGA GGG (reversed) Intergenic