ID: 1047703468

View in Genome Browser
Species Human (GRCh38)
Location 8:127473419-127473441
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047703457_1047703468 14 Left 1047703457 8:127473382-127473404 CCTCCCCACCCTCCGACAAGTAG No data
Right 1047703468 8:127473419-127473441 TTGACCTCTGACTCACTGTGGGG No data
1047703463_1047703468 5 Left 1047703463 8:127473391-127473413 CCTCCGACAAGTAGCTGGTGCTT No data
Right 1047703468 8:127473419-127473441 TTGACCTCTGACTCACTGTGGGG No data
1047703464_1047703468 2 Left 1047703464 8:127473394-127473416 CCGACAAGTAGCTGGTGCTTTCT No data
Right 1047703468 8:127473419-127473441 TTGACCTCTGACTCACTGTGGGG No data
1047703455_1047703468 16 Left 1047703455 8:127473380-127473402 CCCCTCCCCACCCTCCGACAAGT No data
Right 1047703468 8:127473419-127473441 TTGACCTCTGACTCACTGTGGGG No data
1047703458_1047703468 11 Left 1047703458 8:127473385-127473407 CCCCACCCTCCGACAAGTAGCTG No data
Right 1047703468 8:127473419-127473441 TTGACCTCTGACTCACTGTGGGG No data
1047703461_1047703468 9 Left 1047703461 8:127473387-127473409 CCACCCTCCGACAAGTAGCTGGT No data
Right 1047703468 8:127473419-127473441 TTGACCTCTGACTCACTGTGGGG No data
1047703459_1047703468 10 Left 1047703459 8:127473386-127473408 CCCACCCTCCGACAAGTAGCTGG No data
Right 1047703468 8:127473419-127473441 TTGACCTCTGACTCACTGTGGGG No data
1047703456_1047703468 15 Left 1047703456 8:127473381-127473403 CCCTCCCCACCCTCCGACAAGTA No data
Right 1047703468 8:127473419-127473441 TTGACCTCTGACTCACTGTGGGG No data
1047703462_1047703468 6 Left 1047703462 8:127473390-127473412 CCCTCCGACAAGTAGCTGGTGCT No data
Right 1047703468 8:127473419-127473441 TTGACCTCTGACTCACTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047703468 Original CRISPR TTGACCTCTGACTCACTGTG GGG Intergenic
No off target data available for this crispr