ID: 1047704128

View in Genome Browser
Species Human (GRCh38)
Location 8:127480660-127480682
Sequence ATGTCTCTTTAACAGTATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047704128_1047704134 8 Left 1047704128 8:127480660-127480682 CCTTAATACTGTTAAAGAGACAT No data
Right 1047704134 8:127480691-127480713 TACTCAGGAGCTTTTGGGGTTGG No data
1047704128_1047704136 14 Left 1047704128 8:127480660-127480682 CCTTAATACTGTTAAAGAGACAT No data
Right 1047704136 8:127480697-127480719 GGAGCTTTTGGGGTTGGACTGGG No data
1047704128_1047704132 3 Left 1047704128 8:127480660-127480682 CCTTAATACTGTTAAAGAGACAT No data
Right 1047704132 8:127480686-127480708 CCTCTTACTCAGGAGCTTTTGGG No data
1047704128_1047704133 4 Left 1047704128 8:127480660-127480682 CCTTAATACTGTTAAAGAGACAT No data
Right 1047704133 8:127480687-127480709 CTCTTACTCAGGAGCTTTTGGGG No data
1047704128_1047704130 2 Left 1047704128 8:127480660-127480682 CCTTAATACTGTTAAAGAGACAT No data
Right 1047704130 8:127480685-127480707 TCCTCTTACTCAGGAGCTTTTGG No data
1047704128_1047704135 13 Left 1047704128 8:127480660-127480682 CCTTAATACTGTTAAAGAGACAT No data
Right 1047704135 8:127480696-127480718 AGGAGCTTTTGGGGTTGGACTGG No data
1047704128_1047704129 -7 Left 1047704128 8:127480660-127480682 CCTTAATACTGTTAAAGAGACAT No data
Right 1047704129 8:127480676-127480698 GAGACATTTTCCTCTTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047704128 Original CRISPR ATGTCTCTTTAACAGTATTA AGG (reversed) Intergenic
No off target data available for this crispr