ID: 1047707410

View in Genome Browser
Species Human (GRCh38)
Location 8:127513637-127513659
Sequence ATGAACAATAAGAACACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047707407_1047707410 15 Left 1047707407 8:127513599-127513621 CCAATCAAAGAACTCGACAGTGG No data
Right 1047707410 8:127513637-127513659 ATGAACAATAAGAACACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047707410 Original CRISPR ATGAACAATAAGAACACTAC TGG Intergenic
No off target data available for this crispr