ID: 1047713539

View in Genome Browser
Species Human (GRCh38)
Location 8:127575113-127575135
Sequence TGAGCCCCTTGTACCAGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047713532_1047713539 23 Left 1047713532 8:127575067-127575089 CCCAGCCATTCTGCAGAAAGCAA No data
Right 1047713539 8:127575113-127575135 TGAGCCCCTTGTACCAGCGGAGG No data
1047713534_1047713539 18 Left 1047713534 8:127575072-127575094 CCATTCTGCAGAAAGCAATTTTC No data
Right 1047713539 8:127575113-127575135 TGAGCCCCTTGTACCAGCGGAGG No data
1047713533_1047713539 22 Left 1047713533 8:127575068-127575090 CCAGCCATTCTGCAGAAAGCAAT No data
Right 1047713539 8:127575113-127575135 TGAGCCCCTTGTACCAGCGGAGG No data
1047713529_1047713539 28 Left 1047713529 8:127575062-127575084 CCTCCCCCAGCCATTCTGCAGAA No data
Right 1047713539 8:127575113-127575135 TGAGCCCCTTGTACCAGCGGAGG No data
1047713530_1047713539 25 Left 1047713530 8:127575065-127575087 CCCCCAGCCATTCTGCAGAAAGC No data
Right 1047713539 8:127575113-127575135 TGAGCCCCTTGTACCAGCGGAGG No data
1047713531_1047713539 24 Left 1047713531 8:127575066-127575088 CCCCAGCCATTCTGCAGAAAGCA No data
Right 1047713539 8:127575113-127575135 TGAGCCCCTTGTACCAGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047713539 Original CRISPR TGAGCCCCTTGTACCAGCGG AGG Intergenic
No off target data available for this crispr