ID: 1047718162

View in Genome Browser
Species Human (GRCh38)
Location 8:127614870-127614892
Sequence TTTTTTGAACAGATTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047718160_1047718162 13 Left 1047718160 8:127614834-127614856 CCAGGCATGGGAAGGGTGGGAGG No data
Right 1047718162 8:127614870-127614892 TTTTTTGAACAGATTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047718162 Original CRISPR TTTTTTGAACAGATTGAGCA AGG Intergenic
No off target data available for this crispr