ID: 1047722106

View in Genome Browser
Species Human (GRCh38)
Location 8:127650583-127650605
Sequence GGGATCTTGCCAGTATGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047722106_1047722110 11 Left 1047722106 8:127650583-127650605 CCTGGGCATACTGGCAAGATCCC No data
Right 1047722110 8:127650617-127650639 AAAAAATTACAAAAATTAGCTGG 0: 143
1: 4634
2: 18933
3: 133222
4: 171111
1047722106_1047722111 12 Left 1047722106 8:127650583-127650605 CCTGGGCATACTGGCAAGATCCC No data
Right 1047722111 8:127650618-127650640 AAAAATTACAAAAATTAGCTGGG 0: 244
1: 9996
2: 89739
3: 183673
4: 200822
1047722106_1047722113 20 Left 1047722106 8:127650583-127650605 CCTGGGCATACTGGCAAGATCCC No data
Right 1047722113 8:127650626-127650648 CAAAAATTAGCTGGGCATGGTGG 0: 22180
1: 66270
2: 133935
3: 178969
4: 181051
1047722106_1047722112 17 Left 1047722106 8:127650583-127650605 CCTGGGCATACTGGCAAGATCCC No data
Right 1047722112 8:127650623-127650645 TTACAAAAATTAGCTGGGCATGG 0: 310
1: 24186
2: 55936
3: 107509
4: 137092

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047722106 Original CRISPR GGGATCTTGCCAGTATGCCC AGG (reversed) Intergenic
No off target data available for this crispr