ID: 1047722112

View in Genome Browser
Species Human (GRCh38)
Location 8:127650623-127650645
Sequence TTACAAAAATTAGCTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 325033
Summary {0: 310, 1: 24186, 2: 55936, 3: 107509, 4: 137092}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047722106_1047722112 17 Left 1047722106 8:127650583-127650605 CCTGGGCATACTGGCAAGATCCC No data
Right 1047722112 8:127650623-127650645 TTACAAAAATTAGCTGGGCATGG 0: 310
1: 24186
2: 55936
3: 107509
4: 137092
1047722109_1047722112 -5 Left 1047722109 8:127650605-127650627 CCATCTCTACAAAAAAAATTACA No data
Right 1047722112 8:127650623-127650645 TTACAAAAATTAGCTGGGCATGG 0: 310
1: 24186
2: 55936
3: 107509
4: 137092
1047722107_1047722112 -3 Left 1047722107 8:127650603-127650625 CCCCATCTCTACAAAAAAAATTA 0: 123
1: 1116
2: 6494
3: 31543
4: 156891
Right 1047722112 8:127650623-127650645 TTACAAAAATTAGCTGGGCATGG 0: 310
1: 24186
2: 55936
3: 107509
4: 137092
1047722108_1047722112 -4 Left 1047722108 8:127650604-127650626 CCCATCTCTACAAAAAAAATTAC 0: 6
1: 244
2: 2071
3: 9585
4: 40017
Right 1047722112 8:127650623-127650645 TTACAAAAATTAGCTGGGCATGG 0: 310
1: 24186
2: 55936
3: 107509
4: 137092
1047722105_1047722112 21 Left 1047722105 8:127650579-127650601 CCAGCCTGGGCATACTGGCAAGA No data
Right 1047722112 8:127650623-127650645 TTACAAAAATTAGCTGGGCATGG 0: 310
1: 24186
2: 55936
3: 107509
4: 137092

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047722112 Original CRISPR TTACAAAAATTAGCTGGGCA TGG Intergenic
Too many off-targets to display for this crispr