ID: 1047722113

View in Genome Browser
Species Human (GRCh38)
Location 8:127650626-127650648
Sequence CAAAAATTAGCTGGGCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 582405
Summary {0: 22180, 1: 66270, 2: 133935, 3: 178969, 4: 181051}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047722107_1047722113 0 Left 1047722107 8:127650603-127650625 CCCCATCTCTACAAAAAAAATTA 0: 123
1: 1116
2: 6494
3: 31543
4: 156891
Right 1047722113 8:127650626-127650648 CAAAAATTAGCTGGGCATGGTGG 0: 22180
1: 66270
2: 133935
3: 178969
4: 181051
1047722105_1047722113 24 Left 1047722105 8:127650579-127650601 CCAGCCTGGGCATACTGGCAAGA No data
Right 1047722113 8:127650626-127650648 CAAAAATTAGCTGGGCATGGTGG 0: 22180
1: 66270
2: 133935
3: 178969
4: 181051
1047722109_1047722113 -2 Left 1047722109 8:127650605-127650627 CCATCTCTACAAAAAAAATTACA No data
Right 1047722113 8:127650626-127650648 CAAAAATTAGCTGGGCATGGTGG 0: 22180
1: 66270
2: 133935
3: 178969
4: 181051
1047722108_1047722113 -1 Left 1047722108 8:127650604-127650626 CCCATCTCTACAAAAAAAATTAC 0: 6
1: 244
2: 2071
3: 9585
4: 40017
Right 1047722113 8:127650626-127650648 CAAAAATTAGCTGGGCATGGTGG 0: 22180
1: 66270
2: 133935
3: 178969
4: 181051
1047722106_1047722113 20 Left 1047722106 8:127650583-127650605 CCTGGGCATACTGGCAAGATCCC No data
Right 1047722113 8:127650626-127650648 CAAAAATTAGCTGGGCATGGTGG 0: 22180
1: 66270
2: 133935
3: 178969
4: 181051

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047722113 Original CRISPR CAAAAATTAGCTGGGCATGG TGG Intergenic
Too many off-targets to display for this crispr