ID: 1047723211

View in Genome Browser
Species Human (GRCh38)
Location 8:127661638-127661660
Sequence CCTCCCCCCATCCAAAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047723203_1047723211 17 Left 1047723203 8:127661598-127661620 CCAACTTAAAATAACTCCCCTAA No data
Right 1047723211 8:127661638-127661660 CCTCCCCCCATCCAAAGGATGGG No data
1047723204_1047723211 1 Left 1047723204 8:127661614-127661636 CCCCTAACTTTCTTCACAATTCC No data
Right 1047723211 8:127661638-127661660 CCTCCCCCCATCCAAAGGATGGG No data
1047723206_1047723211 -1 Left 1047723206 8:127661616-127661638 CCTAACTTTCTTCACAATTCCTC No data
Right 1047723211 8:127661638-127661660 CCTCCCCCCATCCAAAGGATGGG No data
1047723205_1047723211 0 Left 1047723205 8:127661615-127661637 CCCTAACTTTCTTCACAATTCCT No data
Right 1047723211 8:127661638-127661660 CCTCCCCCCATCCAAAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047723211 Original CRISPR CCTCCCCCCATCCAAAGGAT GGG Intergenic
No off target data available for this crispr