ID: 1047724236

View in Genome Browser
Species Human (GRCh38)
Location 8:127670424-127670446
Sequence CCACGTCACGTAGGGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047724236_1047724242 -7 Left 1047724236 8:127670424-127670446 CCACCAGGCCCTACGTGACGTGG No data
Right 1047724242 8:127670440-127670462 GACGTGGCCCCAGGTAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047724236 Original CRISPR CCACGTCACGTAGGGCCTGG TGG (reversed) Intergenic
No off target data available for this crispr