ID: 1047724237

View in Genome Browser
Species Human (GRCh38)
Location 8:127670424-127670446
Sequence CCACCAGGCCCTACGTGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047724227_1047724237 30 Left 1047724227 8:127670371-127670393 CCCAGCTCAAAATCTTCTGCACT No data
Right 1047724237 8:127670424-127670446 CCACCAGGCCCTACGTGACGTGG No data
1047724229_1047724237 -4 Left 1047724229 8:127670405-127670427 CCCAAGTCCCTACCACAGCCCAC No data
Right 1047724237 8:127670424-127670446 CCACCAGGCCCTACGTGACGTGG No data
1047724230_1047724237 -5 Left 1047724230 8:127670406-127670428 CCAAGTCCCTACCACAGCCCACC No data
Right 1047724237 8:127670424-127670446 CCACCAGGCCCTACGTGACGTGG No data
1047724228_1047724237 29 Left 1047724228 8:127670372-127670394 CCAGCTCAAAATCTTCTGCACTT No data
Right 1047724237 8:127670424-127670446 CCACCAGGCCCTACGTGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047724237 Original CRISPR CCACCAGGCCCTACGTGACG TGG Intergenic
No off target data available for this crispr