ID: 1047724290

View in Genome Browser
Species Human (GRCh38)
Location 8:127670748-127670770
Sequence AGGGCTCTTACAGTTGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047724283_1047724290 2 Left 1047724283 8:127670723-127670745 CCTGTTGCCCATACTCTGTGCCC No data
Right 1047724290 8:127670748-127670770 AGGGCTCTTACAGTTGTCCCAGG No data
1047724282_1047724290 18 Left 1047724282 8:127670707-127670729 CCTTGATTTGCTATCACCTGTTG No data
Right 1047724290 8:127670748-127670770 AGGGCTCTTACAGTTGTCCCAGG No data
1047724287_1047724290 -6 Left 1047724287 8:127670731-127670753 CCATACTCTGTGCCCTCAGGGCT No data
Right 1047724290 8:127670748-127670770 AGGGCTCTTACAGTTGTCCCAGG No data
1047724286_1047724290 -5 Left 1047724286 8:127670730-127670752 CCCATACTCTGTGCCCTCAGGGC No data
Right 1047724290 8:127670748-127670770 AGGGCTCTTACAGTTGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047724290 Original CRISPR AGGGCTCTTACAGTTGTCCC AGG Intergenic
No off target data available for this crispr