ID: 1047725082

View in Genome Browser
Species Human (GRCh38)
Location 8:127677305-127677327
Sequence TATTTTTACTGGACCTAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047725082_1047725087 17 Left 1047725082 8:127677305-127677327 CCTGATTAGGTCCAGTAAAAATA No data
Right 1047725087 8:127677345-127677367 AGGCCCCTAGCTGTTATTATTGG No data
1047725082_1047725084 -3 Left 1047725082 8:127677305-127677327 CCTGATTAGGTCCAGTAAAAATA No data
Right 1047725084 8:127677325-127677347 ATACTTGTGAAATACCTGCCAGG No data
1047725082_1047725091 30 Left 1047725082 8:127677305-127677327 CCTGATTAGGTCCAGTAAAAATA No data
Right 1047725091 8:127677358-127677380 TTATTATTGGCGCCCCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047725082 Original CRISPR TATTTTTACTGGACCTAATC AGG (reversed) Intergenic
No off target data available for this crispr