ID: 1047725083

View in Genome Browser
Species Human (GRCh38)
Location 8:127677316-127677338
Sequence TATTTCACAAGTATTTTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047725083_1047725091 19 Left 1047725083 8:127677316-127677338 CCAGTAAAAATACTTGTGAAATA No data
Right 1047725091 8:127677358-127677380 TTATTATTGGCGCCCCTGCAAGG No data
1047725083_1047725087 6 Left 1047725083 8:127677316-127677338 CCAGTAAAAATACTTGTGAAATA No data
Right 1047725087 8:127677345-127677367 AGGCCCCTAGCTGTTATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047725083 Original CRISPR TATTTCACAAGTATTTTTAC TGG (reversed) Intergenic
No off target data available for this crispr