ID: 1047725083 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:127677316-127677338 |
| Sequence | TATTTCACAAGTATTTTTAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1047725083_1047725091 | 19 | Left | 1047725083 | 8:127677316-127677338 | CCAGTAAAAATACTTGTGAAATA | No data | ||
| Right | 1047725091 | 8:127677358-127677380 | TTATTATTGGCGCCCCTGCAAGG | No data | ||||
| 1047725083_1047725087 | 6 | Left | 1047725083 | 8:127677316-127677338 | CCAGTAAAAATACTTGTGAAATA | No data | ||
| Right | 1047725087 | 8:127677345-127677367 | AGGCCCCTAGCTGTTATTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1047725083 | Original CRISPR | TATTTCACAAGTATTTTTAC TGG (reversed) | Intergenic | ||