ID: 1047725085

View in Genome Browser
Species Human (GRCh38)
Location 8:127677339-127677361
Sequence ATAACAGCTAGGGGCCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047725085_1047725091 -4 Left 1047725085 8:127677339-127677361 CCTGCCAGGCCCCTAGCTGTTAT No data
Right 1047725091 8:127677358-127677380 TTATTATTGGCGCCCCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047725085 Original CRISPR ATAACAGCTAGGGGCCTGGC AGG (reversed) Intergenic
No off target data available for this crispr