ID: 1047725087

View in Genome Browser
Species Human (GRCh38)
Location 8:127677345-127677367
Sequence AGGCCCCTAGCTGTTATTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047725083_1047725087 6 Left 1047725083 8:127677316-127677338 CCAGTAAAAATACTTGTGAAATA No data
Right 1047725087 8:127677345-127677367 AGGCCCCTAGCTGTTATTATTGG No data
1047725082_1047725087 17 Left 1047725082 8:127677305-127677327 CCTGATTAGGTCCAGTAAAAATA No data
Right 1047725087 8:127677345-127677367 AGGCCCCTAGCTGTTATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047725087 Original CRISPR AGGCCCCTAGCTGTTATTAT TGG Intergenic
No off target data available for this crispr