ID: 1047725091

View in Genome Browser
Species Human (GRCh38)
Location 8:127677358-127677380
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047725082_1047725091 30 Left 1047725082 8:127677305-127677327 CCTGATTAGGTCCAGTAAAAATA No data
Right 1047725091 8:127677358-127677380 TTATTATTGGCGCCCCTGCAAGG No data
1047725086_1047725091 -8 Left 1047725086 8:127677343-127677365 CCAGGCCCCTAGCTGTTATTATT No data
Right 1047725091 8:127677358-127677380 TTATTATTGGCGCCCCTGCAAGG No data
1047725085_1047725091 -4 Left 1047725085 8:127677339-127677361 CCTGCCAGGCCCCTAGCTGTTAT No data
Right 1047725091 8:127677358-127677380 TTATTATTGGCGCCCCTGCAAGG No data
1047725083_1047725091 19 Left 1047725083 8:127677316-127677338 CCAGTAAAAATACTTGTGAAATA No data
Right 1047725091 8:127677358-127677380 TTATTATTGGCGCCCCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047725091 Original CRISPR TTATTATTGGCGCCCCTGCA AGG Intergenic