ID: 1047728867

View in Genome Browser
Species Human (GRCh38)
Location 8:127709199-127709221
Sequence AAGAATGAGGCCAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047728867_1047728871 28 Left 1047728867 8:127709199-127709221 CCGGCCTCCTTGGCCTCATTCTT No data
Right 1047728871 8:127709250-127709272 ACACCATTGAACCTTAGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047728867 Original CRISPR AAGAATGAGGCCAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr