ID: 1047735410

View in Genome Browser
Species Human (GRCh38)
Location 8:127760912-127760934
Sequence CCTCCAGGGCAGAGCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047735410_1047735418 24 Left 1047735410 8:127760912-127760934 CCATCCTGGCTCTGCCCTGGAGG No data
Right 1047735418 8:127760959-127760981 GCGCTTGATGTCTCACTCCTAGG No data
1047735410_1047735419 25 Left 1047735410 8:127760912-127760934 CCATCCTGGCTCTGCCCTGGAGG No data
Right 1047735419 8:127760960-127760982 CGCTTGATGTCTCACTCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047735410 Original CRISPR CCTCCAGGGCAGAGCCAGGA TGG (reversed) Intergenic
No off target data available for this crispr