ID: 1047739988

View in Genome Browser
Species Human (GRCh38)
Location 8:127798598-127798620
Sequence TCCCAAAGTGCTGGGATTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1020377
Summary {0: 284556, 1: 262309, 2: 153276, 3: 130613, 4: 189623}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047739988_1047739997 8 Left 1047739988 8:127798598-127798620 CCCGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1047739997 8:127798629-127798651 CCGGTAGATTACCTGAGGTCAGG No data
1047739988_1047739999 26 Left 1047739988 8:127798598-127798620 CCCGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1047739999 8:127798647-127798669 TCAGGAGTTCAAGACCAGCCTGG 0: 50001
1: 120441
2: 170670
3: 194372
4: 129314
1047739988_1047739995 3 Left 1047739988 8:127798598-127798620 CCCGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1047739995 8:127798624-127798646 TGAGGCCGGTAGATTACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047739988 Original CRISPR TCCCAAAGTGCTGGGATTAC GGG (reversed) Intergenic
Too many off-targets to display for this crispr