ID: 1047739991

View in Genome Browser
Species Human (GRCh38)
Location 8:127798606-127798628
Sequence CCTCAGCCTCCCAAAGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1095746
Summary {0: 90349, 1: 212695, 2: 235979, 3: 260133, 4: 296590}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047739991_1047740000 27 Left 1047739991 8:127798606-127798628 CCCAGCACTTTGGGAGGCTGAGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
Right 1047740000 8:127798656-127798678 CAAGACCAGCCTGGCCAGCATGG 0: 802
1: 39659
2: 111818
3: 169979
4: 177835
1047739991_1047739995 -5 Left 1047739991 8:127798606-127798628 CCCAGCACTTTGGGAGGCTGAGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
Right 1047739995 8:127798624-127798646 TGAGGCCGGTAGATTACCTGAGG No data
1047739991_1047739999 18 Left 1047739991 8:127798606-127798628 CCCAGCACTTTGGGAGGCTGAGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
Right 1047739999 8:127798647-127798669 TCAGGAGTTCAAGACCAGCCTGG 0: 50001
1: 120441
2: 170670
3: 194372
4: 129314
1047739991_1047739997 0 Left 1047739991 8:127798606-127798628 CCCAGCACTTTGGGAGGCTGAGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
Right 1047739997 8:127798629-127798651 CCGGTAGATTACCTGAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047739991 Original CRISPR CCTCAGCCTCCCAAAGTGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr