ID: 1047739993

View in Genome Browser
Species Human (GRCh38)
Location 8:127798607-127798629
Sequence GCCTCAGCCTCCCAAAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1020000
Summary {0: 56931, 1: 168651, 2: 218048, 3: 269456, 4: 306914}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047739993_1047739995 -6 Left 1047739993 8:127798607-127798629 CCAGCACTTTGGGAGGCTGAGGC 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
Right 1047739995 8:127798624-127798646 TGAGGCCGGTAGATTACCTGAGG No data
1047739993_1047739997 -1 Left 1047739993 8:127798607-127798629 CCAGCACTTTGGGAGGCTGAGGC 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
Right 1047739997 8:127798629-127798651 CCGGTAGATTACCTGAGGTCAGG No data
1047739993_1047740000 26 Left 1047739993 8:127798607-127798629 CCAGCACTTTGGGAGGCTGAGGC 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
Right 1047740000 8:127798656-127798678 CAAGACCAGCCTGGCCAGCATGG 0: 802
1: 39659
2: 111818
3: 169979
4: 177835
1047739993_1047739999 17 Left 1047739993 8:127798607-127798629 CCAGCACTTTGGGAGGCTGAGGC 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
Right 1047739999 8:127798647-127798669 TCAGGAGTTCAAGACCAGCCTGG 0: 50001
1: 120441
2: 170670
3: 194372
4: 129314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047739993 Original CRISPR GCCTCAGCCTCCCAAAGTGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr