ID: 1047739997

View in Genome Browser
Species Human (GRCh38)
Location 8:127798629-127798651
Sequence CCGGTAGATTACCTGAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047739991_1047739997 0 Left 1047739991 8:127798606-127798628 CCCAGCACTTTGGGAGGCTGAGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
Right 1047739997 8:127798629-127798651 CCGGTAGATTACCTGAGGTCAGG No data
1047739988_1047739997 8 Left 1047739988 8:127798598-127798620 CCCGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1047739997 8:127798629-127798651 CCGGTAGATTACCTGAGGTCAGG No data
1047739989_1047739997 7 Left 1047739989 8:127798599-127798621 CCGTAATCCCAGCACTTTGGGAG 0: 4251
1: 4726
2: 3577
3: 3425
4: 5834
Right 1047739997 8:127798629-127798651 CCGGTAGATTACCTGAGGTCAGG No data
1047739993_1047739997 -1 Left 1047739993 8:127798607-127798629 CCAGCACTTTGGGAGGCTGAGGC 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
Right 1047739997 8:127798629-127798651 CCGGTAGATTACCTGAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047739997 Original CRISPR CCGGTAGATTACCTGAGGTC AGG Intergenic
No off target data available for this crispr