ID: 1047742485

View in Genome Browser
Species Human (GRCh38)
Location 8:127818011-127818033
Sequence CTAGTTACTGCCCCTCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047742485_1047742496 29 Left 1047742485 8:127818011-127818033 CCCAGGAGAGGGGCAGTAACTAG No data
Right 1047742496 8:127818063-127818085 CTTCCCCTCAACGTGGGCCAAGG No data
1047742485_1047742495 23 Left 1047742485 8:127818011-127818033 CCCAGGAGAGGGGCAGTAACTAG No data
Right 1047742495 8:127818057-127818079 AGTTTACTTCCCCTCAACGTGGG No data
1047742485_1047742489 -4 Left 1047742485 8:127818011-127818033 CCCAGGAGAGGGGCAGTAACTAG No data
Right 1047742489 8:127818030-127818052 CTAGCAGAAGGGAAACAGCCCGG No data
1047742485_1047742494 22 Left 1047742485 8:127818011-127818033 CCCAGGAGAGGGGCAGTAACTAG No data
Right 1047742494 8:127818056-127818078 CAGTTTACTTCCCCTCAACGTGG No data
1047742485_1047742490 -3 Left 1047742485 8:127818011-127818033 CCCAGGAGAGGGGCAGTAACTAG No data
Right 1047742490 8:127818031-127818053 TAGCAGAAGGGAAACAGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047742485 Original CRISPR CTAGTTACTGCCCCTCTCCT GGG (reversed) Intergenic
No off target data available for this crispr