ID: 1047743132

View in Genome Browser
Species Human (GRCh38)
Location 8:127823356-127823378
Sequence AATTTAAGCATATCAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047743132_1047743135 8 Left 1047743132 8:127823356-127823378 CCTGCTTTTGATATGCTTAAATT No data
Right 1047743135 8:127823387-127823409 GATATCTTTTTGAAAGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047743132 Original CRISPR AATTTAAGCATATCAAAAGC AGG (reversed) Intergenic
No off target data available for this crispr