ID: 1047743630

View in Genome Browser
Species Human (GRCh38)
Location 8:127827448-127827470
Sequence GGCTGATGGCTCCCCTATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047743630_1047743632 -4 Left 1047743630 8:127827448-127827470 CCTGTATAGGGGAGCCATCAGCC No data
Right 1047743632 8:127827467-127827489 AGCCTGACTGAGCAGCCCTGAGG No data
1047743630_1047743634 0 Left 1047743630 8:127827448-127827470 CCTGTATAGGGGAGCCATCAGCC No data
Right 1047743634 8:127827471-127827493 TGACTGAGCAGCCCTGAGGCTGG No data
1047743630_1047743635 9 Left 1047743630 8:127827448-127827470 CCTGTATAGGGGAGCCATCAGCC No data
Right 1047743635 8:127827480-127827502 AGCCCTGAGGCTGGAGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047743630 Original CRISPR GGCTGATGGCTCCCCTATAC AGG (reversed) Intergenic