ID: 1047748093

View in Genome Browser
Species Human (GRCh38)
Location 8:127860188-127860210
Sequence GGTCCTGGTGGCGGAGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047748085_1047748093 4 Left 1047748085 8:127860161-127860183 CCAGTGAGCTCCAGGAGACGAGG No data
Right 1047748093 8:127860188-127860210 GGTCCTGGTGGCGGAGGTGCTGG No data
1047748084_1047748093 5 Left 1047748084 8:127860160-127860182 CCCAGTGAGCTCCAGGAGACGAG No data
Right 1047748093 8:127860188-127860210 GGTCCTGGTGGCGGAGGTGCTGG No data
1047748083_1047748093 11 Left 1047748083 8:127860154-127860176 CCGGCTCCCAGTGAGCTCCAGGA No data
Right 1047748093 8:127860188-127860210 GGTCCTGGTGGCGGAGGTGCTGG No data
1047748088_1047748093 -6 Left 1047748088 8:127860171-127860193 CCAGGAGACGAGGAGCAGGTCCT No data
Right 1047748093 8:127860188-127860210 GGTCCTGGTGGCGGAGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047748093 Original CRISPR GGTCCTGGTGGCGGAGGTGC TGG Intergenic