ID: 1047752696

View in Genome Browser
Species Human (GRCh38)
Location 8:127893838-127893860
Sequence GTGTATACGAGGATGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047752687_1047752696 30 Left 1047752687 8:127893785-127893807 CCTGGAGACTTGAGAGTGAAAGG No data
Right 1047752696 8:127893838-127893860 GTGTATACGAGGATGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047752696 Original CRISPR GTGTATACGAGGATGTAGCT GGG Intergenic
No off target data available for this crispr