ID: 1047756451

View in Genome Browser
Species Human (GRCh38)
Location 8:127922671-127922693
Sequence CACTGTGTTGGCAGTAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047756451_1047756465 27 Left 1047756451 8:127922671-127922693 CCCACTCTACTGCCAACACAGTG No data
Right 1047756465 8:127922721-127922743 CGAGGTCCTGCAGGCTGGACAGG No data
1047756451_1047756458 -9 Left 1047756451 8:127922671-127922693 CCCACTCTACTGCCAACACAGTG No data
Right 1047756458 8:127922685-127922707 AACACAGTGGTAGGAAGGGAAGG No data
1047756451_1047756463 18 Left 1047756451 8:127922671-127922693 CCCACTCTACTGCCAACACAGTG No data
Right 1047756463 8:127922712-127922734 AGGCTTAGGCGAGGTCCTGCAGG No data
1047756451_1047756462 9 Left 1047756451 8:127922671-127922693 CCCACTCTACTGCCAACACAGTG No data
Right 1047756462 8:127922703-127922725 GAAGGCGGCAGGCTTAGGCGAGG No data
1047756451_1047756460 -2 Left 1047756451 8:127922671-127922693 CCCACTCTACTGCCAACACAGTG No data
Right 1047756460 8:127922692-127922714 TGGTAGGAAGGGAAGGCGGCAGG No data
1047756451_1047756464 22 Left 1047756451 8:127922671-127922693 CCCACTCTACTGCCAACACAGTG No data
Right 1047756464 8:127922716-127922738 TTAGGCGAGGTCCTGCAGGCTGG No data
1047756451_1047756459 -6 Left 1047756451 8:127922671-127922693 CCCACTCTACTGCCAACACAGTG No data
Right 1047756459 8:127922688-127922710 ACAGTGGTAGGAAGGGAAGGCGG No data
1047756451_1047756461 4 Left 1047756451 8:127922671-127922693 CCCACTCTACTGCCAACACAGTG No data
Right 1047756461 8:127922698-127922720 GAAGGGAAGGCGGCAGGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047756451 Original CRISPR CACTGTGTTGGCAGTAGAGT GGG (reversed) Intergenic
No off target data available for this crispr